GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-05-16 17:13:25, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_062931429            2346 bp    mRNA    linear   PLN 07-FEB-2024
DEFINITION  Colletotrichum destructivum Putative PAZ domain, Piwi domain,
            ribonuclease H-like superfamily, argonaute, linker 1 (CDEST_15273),
            partial mRNA.
ACCESSION   XM_062931429
VERSION     XM_062931429.1
DBLINK      BioProject: PRJNA1073607
            BioSample: SAMN37882108
KEYWORDS    RefSeq.
SOURCE      Colletotrichum destructivum
  ORGANISM  Colletotrichum destructivum
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Sordariomycetes; Hypocreomycetidae; Glomerellales; Glomerellaceae;
            Colletotrichum; Colletotrichum destructivum species complex.
REFERENCE   1  (bases 1 to 2346)
  AUTHORS   Lapalu,N., Simon,A., Lu,A., Plaumann,P.-L., Amselem,J., Pigne,S.,
            Auger,A., Koch,C., Dallery,J.-F. and O'Connell,R.J.
  TITLE     Complete genome of the Medicago anthracnose fungus, Colletotrichum
            destructivum, reveals a mini-chromosome-like region within a core
            chromosome
  JOURNAL   bioRxiv (2023)
  REMARK    DOI: 10.1101/2023.12.16.571984
REFERENCE   2  (bases 1 to 2346)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (06-FEB-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 2346)
  AUTHORS   Lapalu,N., Simon,A., Lu,A., Plaumann,P.-L., Amselem,J., Pigne,S.,
            Auger,A., Koch,C., Dallery,J.-F. and O'Connell,R.J.
  TITLE     Direct Submission
  JOURNAL   Submitted (19-OCT-2023) SPE_BIOGER, INRAE, 22 place de l'agronomie,
            Palaiseau 91120, France
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_085906).
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..2346
                     /organism="Colletotrichum destructivum"
                     /mol_type="mRNA"
                     /strain="CBS 520.97"
                     /host="Medicago sativa"
                     /db_xref="taxon:34406"
                     /chromosome="11"
                     /geo_loc_name="Saudi Arabia"
                     /collection_date="1994-08-01"
     gene            <1..2346
                     /locus_tag="CDEST_15273"
                     /db_xref="GeneID:87951773"
     CDS             1..2313
                     /locus_tag="CDEST_15273"
                     /codon_start=1
                     /product="Putative PAZ domain, Piwi domain, ribonuclease
                     H-like superfamily, argonaute, linker 1"
                     /protein_id="XP_062787480.1"
                     /db_xref="GeneID:87951773"
                     /translation="
MRCSPNLLVRLFSCVQYRAQLANLLDRTQDGSIPRPDTAVTTIEDALEADRATPSLNKLSLETVLPQRPGYGTRGTPITLWANYVELVTSPSLKLYRYDISVSPSTTGRKLTQVIRLLLQAPALIALQQDVVSDFKATLLSRQKLSQDNIHFPIRYRAEGEDEPRENAREYDVRLRYAGTLTIAELTEYLASTDLTTNYVEKLPMIQAFNILLNHYSKSSGHLITIGSSKTFSLSQSSSALDIGAGLTAMRGFFASVRAATCRILVNINVSHGAFYQAGPLDQLVLRFDAQLRSKSKIEAFLKRLRVRTTHLPERTNRSGEVIPRVRTIFGVATPSDGQGLAHPPRVREYGAGPKHVEFWLDNPARTEPSTREETSSGKRKRKNKNKNKEKVAAPCDPSASTTSGKYISVYDFSLTSYGRQIDNPDIPVVNVGTRENPTYLPPEVCVVVQGQTAKSRLSPGQTQQMMRFAVRKPRDNATSIVQEGLETTGLSPQTNVLLGRFGLSVTPSLITVPGRHLTEPKVVYKQNKLARVFLGNWSMVDMQFNTAGTLKKWSYVLLSLPSYRDAFNVASLAAVIQSFGSALNATGIMVDPPLQGRRLLLSSSDDGQLDQLLKEAALYLDFLLIVLPDTNTPLYNRIKRCGDLKYGIHTICVVGHKLAKQTGQDQYFANIALKMNLKLGGNNQLIDSSQLGLVSEDKTMVVGIDVTHPSPDSSRRAPSVAGMVASVDRWLGQWPAVLRIQSEARQEMVSGLTDMLKLRLRLWKDIGKH"
     misc_feature    202..>2259
                     /locus_tag="CDEST_15273"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    1495..>2298
                     /locus_tag="CDEST_15273"
                     /note="PIWI domain. Domain found in proteins involved in
                     RNA silencing. RNA silencing refers to a group of related
                     gene-silencing mechanisms mediated by short RNA molecules,
                     including siRNAs, miRNAs, and heterochromatin-related
                     guide RNAs. The central component...; Region: Piwi-like;
                     cl00628"
                     /db_xref="CDD:412485"
     misc_feature    order(1906..1908,1918..1920,1954..1965,1972..1974,
                     2002..2004,2011..2013,2023..2025,2035..2037)
                     /locus_tag="CDEST_15273"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:239208"
ORIGIN      
atgcggtgcagccctaatcttctcgtgcggctttttagttgcgttcaatatcgtgcacagctggctaacctcttagataggacacaggatggaagcattcctcgacctgatacggctgtgactacaatagaagacgctctcgaggctgacagagccacgccatctttgaataagcttagtttggaaactgtcttacctcagcggccgggatacggtacgagaggcacccccatcacactctgggctaactatgtcgaattggtcacgtctcccagcttgaagctctaccgatacgatatatctgtgtccccgagtacgactggcaggaaactgacccaggtcatccgacttctgctgcaagcgccggcactgatagcactccagcaggatgttgtttctgacttcaaagcgactctgctttcgcggcaaaagttgtctcaggataacatccatttcccaatccgctatcgagccgagggcgaagatgagcctcgggagaacgctagggagtatgacgtgcgactccgctatgcgggtaccttgactatcgcggagcttactgagtacctggcgtctactgacttgacgacaaactatgtcgaaaagctgcctatgatccaggcattcaacattcttctgaaccattattccaagtcgtctgggcatctcatcacgattggttcatccaagactttctcgttgagccagagctcttccgctctagacattggcgctggattaaccgccatgcgaggtttctttgccagcgttcgagcggcaacctgccggatcttggtcaatatcaatgtcagccacggggccttctatcaagcaggtccgctggatcagttggtcttgcgatttgatgctcagttaagaagtaagagcaagattgaagcctttttgaagaggctaagggtaaggactactcaccttcccgaaaggacaaacaggagcggcgaggttattccccgggtcagaaccattttcggggttgctacccctagtgacggtcagggtcttgcacatccgccgagggtaagggagtacggtgccggtccgaaacatgtcgagttctggttagacaacccggctcggaccgaaccatcaacaagagaagagacgagttcagggaaaaggaagaggaagaataagaacaagaacaaagaaaaggtggctgccccttgcgacccgtctgcgtctacgacaagcgggaaatacattagtgtttacgacttttccttgacctcatatggcagacaaatcgacaatccagatattcccgttgtgaatgttggtacgagagagaacccaacgtaccttccgcccgaggtctgcgttgttgtacaagggcaaaccgccaaatcgcgactgagccccggtcagacgcaacagatgatgcgatttgcggttcgcaagccgagagataatgcgacatctatcgtccaggagggactcgaaacaactggtctctccccgcagacaaacgttctcctgggccgattcggtctctccgtcacgccaagcctgatcacggttccggggcgccatctgacggagcccaaggttgtgtacaagcaaaacaagctcgctcgagtgtttttgggtaactggagcatggttgacatgcagttcaacacggccgggactcttaaaaaatggtcatatgtgctcctttcgctaccgagctaccgagacgcattcaatgtggcaagtctggctgctgtcattcagagctttggaagcgcattaaacgcaacagggatcatggtggaccctccactgcaggggcgcaggctacttctcagcagctcagacgatgggcaactggaccaactccttaaggaagcagccctatatctcgatttccttctcattgtcctaccggataccaacactccgctctacaaccgaatcaaacgttgcggcgatttaaagtacggtatccacacgatctgtgttgttggccataagcttgccaagcaaacaggccaggaccaatacttcgccaatatcgccttgaagatgaacctcaagctaggcggaaacaaccagctaattgacagctcccaacttgggcttgtcagcgaggataagacaatggtcgtggggatcgacgtgacccacccgtctccagattcgagccgtcgtgcgccgagcgttgccggaatggtcgccagcgtggatagatggcttggacagtggcctgctgtactacggatccagtctgaggcgcgccaggaaatggtgtcaggcttgacggacatgcttaagttacgactacgactgtggaaagacattggaaagcactgagacctgcctgaaaatatccttgtgtattgcgat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]