2024-10-04 21:28:02, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS XM_062507590 1779 bp mRNA linear VRT 26-JAN-2024 DEFINITION PREDICTED: Cinclus cinclus vimentin (VIM), mRNA. ACCESSION XM_062507590 VERSION XM_062507590.1 DBLINK BioProject: PRJNA1066473 KEYWORDS RefSeq. SOURCE Cinclus cinclus ORGANISM Cinclus cinclus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Passeriformes; Cinclidae; Cinclus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_085046) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_963662255.1-RS_2024_01 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 01/19/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1779 /organism="Cinclus cinclus" /mol_type="mRNA" /db_xref="taxon:127875" /chromosome="1" gene 1..1779 /gene="VIM" /note="vimentin; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 44 Proteins" /db_xref="GeneID:134052866" CDS 81..1460 /gene="VIM" /codon_start=1 /product="vimentin" /protein_id="XP_062363574.1" /db_xref="GeneID:134052866" /translation="
MSISTKNSSYRRMFGGGSRPSTGTRYITSSSRYSLGSALRPSSARYVSASPGGMYATKTTSVRLRSSMPPMRLHDSVDFTLADAINTEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDIMRLREKLQEEMLQREEAESTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQAQLQEQHIQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQEANEYRRQIQSLTCEVDALKGSNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRINMPIPTFAALNLRETNIESQPMVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
polyA_site 1779 /gene="VIM" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
cgcggccaccgcccttcttcgccgcacacccaggtcgccccactccgctcccggattacaaagcccgagccgccgtcgcaatgagcatcagcacgaaaaactcgtcgtaccgccgcatgttcggcgggggcagccgccccagcaccggcacccggtacatcacgtccagcagccggtactcgctgggcagcgccctgcggcccagcagcgcccggtacgtgtccgcctcgcccggcggcatgtacgccactaagacgacgtcggtgcggctgcggagcagcatgccgcccatgcggctccacgactccgtggatttcaccctggccgacgccatcaacacggagttcaaggcgaaccgcaccaacgagaaggttgagctgcaggagcttaatgaccgcttcgccaactacatcgacaaggtgcgcttcctagagcagcagaacaagatcttgctggccgagctggagcagctcaagggcaagggcacgtcccgcctgggcgacctgtacgaggaggagatgcgggagctgcggcgacaggtggaccagctcaccaacgacaaggcacgcgtggaagtggagcgggacaacctcgccgacgacatcatgcggctgcgggagaagttgcaagaggagatgcttcaaagagaggaggctgagagtaccctgcagtccttcagacaggatgttgacaatgcctctctggcacgtcttgatcttgagcgcaaagttgagtccctgcaagaagagattgtcttcttgaagaagcttcatgatgaggaaatccgagaattgcaagcccaactccaggaacagcacatccagattgatatggatgtttctaagcctgatcttactgctgccctgcgtgacgttcgccagcagtatgaaagtgttgctgctaagaatcttcaggaggctgaagagtggtacaagtccaaatttgcagatctctctgaagctgctaacaggaacaatgatgccctgcgccaggccaagcaggaagcgaatgagtaccgcagacagatccagtctctcacctgcgaagtggatgctctcaagggaagcaatgagtccttggagcgccagatgcgtgaaatggaggagaattttgctgttgaagctgctaactaccaagacactattggccgtctgcaggatgagatccagaacatgaaggaagaaatggctcgccatctccgcgagtaccaggacctgctgaatgtaaagatggctcttgatattgagattgccacctacagaaaactgctggagggtgaagagagcaggattaacatgcctattccaacctttgctgctttgaacctgagagaaaccaacattgagtctcagccaatggttgacactcactcaaagagaacacttctaattaagaccgtcgaaactagagatggacaggttattaatgaaacttcccagcatcacgatgacttggagtaaagctgaagagaagatgcataaaaaggagaaattcttaccagcaagattgaaaaagtccatgtcttaaaggaagaaacagctttcaagtgcctttctgcagtttttccatgagcgcaagatgattatgctaggaaataggtcttagatcttgcaaactgactctccctaaaggattagagtttacaatggagtctagtttacaaatagcaatatcttgtgctgcaatactgtttttaagtatctgaattcaataaaactgctttttccagcacagtatgagcaacctgtcgctacttcaataaatctttggaaaatggct
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]