GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-05-23 23:39:16, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_061997065            1809 bp    mRNA    linear   VRT 02-JAN-2024
DEFINITION  PREDICTED: Colius striatus vimentin (VIM), mRNA.
ACCESSION   XM_061997065
VERSION     XM_061997065.1
DBLINK      BioProject: PRJNA1057818
KEYWORDS    RefSeq.
SOURCE      Colius striatus (speckled mousebird)
  ORGANISM  Colius striatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Telluraves;
            Coraciimorphae; Coliiformes; Coliidae; Colius.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_084763) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_028858725.1-RS_2023_12
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 12/28/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1809
                     /organism="Colius striatus"
                     /mol_type="mRNA"
                     /isolate="bColStr4"
                     /db_xref="taxon:57412"
                     /chromosome="5"
                     /sex="female"
                     /tissue_type="lung"
                     /dev_stage="adult"
                     /geo_loc_name="Denmark: Copenhagen Zoo"
                     /lat_lon="55.67256961 N 12.52133664 E"
                     /collected_by="Mads Bertelsen"
     gene            1..1809
                     /gene="VIM"
                     /note="vimentin; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 32 Proteins"
                     /db_xref="GeneID:104560015"
     CDS             107..1486
                     /gene="VIM"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="XP_061853049.1"
                     /db_xref="GeneID:104560015"
                     /translation="
MSVTTKNSSYRRMFGGGSRPSTGTRYITSSSRYSLGSSLRPSAARYVSASPGGMYATKSTSVRLRSSMPPMRLHDSVDFSLADAINTEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDIMRLREKLQEEMLQREEAENTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQAQLQEQHIQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQEANEYRRQIQSLTCEVDALKGSNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRINMPIPTFASLNLRETNIESQPMVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
     misc_feature    128..388
                     /gene="VIM"
                     /note="Intermediate filament head (DNA binding) region;
                     Region: Filament_head; pfam04732"
                     /db_xref="CDD:461414"
     misc_feature    389..1315
                     /gene="VIM"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:459643"
     polyA_site      1809
                     /gene="VIM"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
aaggggcccggggccggggccgccgcccttgttcgcccgtcgcgccgcgcacccgcagccagctcgtcccgcgccgctcccggattacaaagcccctgccgccgctatgagcgtcaccaccaagaactcctcgtaccgccgcatgttcggcgggggcagccgccccagcaccggcacccgctacatcacctcgagcagccgctactcgctgggcagctccctgcggcccagcgccgcccgctacgtgtccgcttcgcccggcggcatgtacgccaccaagtccacgtcggtgcggctgaggagcagcatgccgcccatgcggctccacgactccgtggacttctccctggccgacgccatcaacacggagttcaaggcgaaccgcaccaacgagaaggtggagctgcaggagctcaacgaccgcttcgccaactacatcgacaaggtgcgattcctggagcagcagaacaagatcctgctggccgagctggagcagctcaaaggcaagggcacgtctcgcctgggtgacctgtacgaggaggagatgcgggagctgcggcggcaggtggaccagctcaccaacgacaaggcgcgcgtggaggtggagcgggacaacctggccgacgacatcatgcggctgcgggagaagttgcaagaggagatgctgcagcgggaggaggctgagaacaccctacagtccttcagacaggatgttgacaatgcctctctggcacgtcttgatcttgagcgcaaagttgagtccctgcaagaggagattgtcttcttgaagaagcttcatgatgaggaaatccgagagctgcaggcccaactccaggaacagcacatccagattgatatggatgtttctaagcctgaccttactgctgccctgcgtgacgttcgccaacagtacgaaagcgttgctgctaagaatcttcaggaagctgaagagtggtacaagtccaaatttgcagacctctccgaagctgctaaccggaacaacgatgccctgcgccaggccaaacaggaggccaatgagtaccgcaggcagattcagtctctcacctgcgaggtcgatgctctgaagggaagcaacgaatccctggagcgccaaatgcgtgaaatggaggagaactttgctgttgaagctgctaactaccaggacactattgggcgtctgcaggacgagattcagaacatgaaggaagaaatggctcgtcatctccgcgagtaccaggacctgctgaatgtaaagatggctcttgatattgagattgccacctacagaaaactgctggagggtgaagagagcaggattaacatgcctattccaacctttgcttctttgaacctgagagaaaccaacattgagtctcagccaatggttgatactcactcaaagaggacacttctaattaagactgtcgaaactagagatggacaggttattaatgaaacttcccagcatcacgatgacttggagtaaaactgaagatgcagactcagaatgcaggagaaattcttaccagcaagatttaaaaagtccatgtcttaaaggaagaaacagctttcaagtgcctttctgcagtttttccatgagcgcaagattattatgctaggaaataggtcttagatcttgcaaactgactctccctgaaggattagagtttacaatggagtctagtttacaaatagcaatatcttgtgctgcaatactgtttttaaagtattctgaattcaataaaactgcttctttttccagcacagtatgagcaacctgtcgctacttcaataaatctttggaaaatg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]