ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-28 06:37:05, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_061997065 1809 bp mRNA linear VRT 02-JAN-2024 DEFINITION PREDICTED: Colius striatus vimentin (VIM), mRNA. ACCESSION XM_061997065 VERSION XM_061997065.1 DBLINK BioProject: PRJNA1057818 KEYWORDS RefSeq. SOURCE Colius striatus (speckled mousebird) ORGANISM Colius striatus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Coraciimorphae; Coliiformes; Coliidae; Colius. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_084763) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_028858725.1-RS_2023_12 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 12/28/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1809 /organism="Colius striatus" /mol_type="mRNA" /isolate="bColStr4" /db_xref="taxon:57412" /chromosome="5" /sex="female" /tissue_type="lung" /dev_stage="adult" /geo_loc_name="Denmark: Copenhagen Zoo" /lat_lon="55.67256961 N 12.52133664 E" /collected_by="Mads Bertelsen" gene 1..1809 /gene="VIM" /note="vimentin; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 32 Proteins" /db_xref="GeneID:104560015" CDS 107..1486 /gene="VIM" /codon_start=1 /product="vimentin" /protein_id="XP_061853049.1" /db_xref="GeneID:104560015" /translation="
MSVTTKNSSYRRMFGGGSRPSTGTRYITSSSRYSLGSSLRPSAARYVSASPGGMYATKSTSVRLRSSMPPMRLHDSVDFSLADAINTEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDIMRLREKLQEEMLQREEAENTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQAQLQEQHIQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQEANEYRRQIQSLTCEVDALKGSNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRINMPIPTFASLNLRETNIESQPMVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
misc_feature 128..388
/gene="VIM"
/note="Intermediate filament head (DNA binding) region;
Region: Filament_head; pfam04732"
/db_xref="CDD:461414"
misc_feature 389..1315
/gene="VIM"
/note="Intermediate filament protein; Region: Filament;
pfam00038"
/db_xref="CDD:459643"
polyA_site 1809
/gene="VIM"
/experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN
aaggggcccggggccggggccgccgcccttgttcgcccgtcgcgccgcgcacccgcagccagctcgtcccgcgccgctcccggattacaaagcccctgccgccgctatgagcgtcaccaccaagaactcctcgtaccgccgcatgttcggcgggggcagccgccccagcaccggcacccgctacatcacctcgagcagccgctactcgctgggcagctccctgcggcccagcgccgcccgctacgtgtccgcttcgcccggcggcatgtacgccaccaagtccacgtcggtgcggctgaggagcagcatgccgcccatgcggctccacgactccgtggacttctccctggccgacgccatcaacacggagttcaaggcgaaccgcaccaacgagaaggtggagctgcaggagctcaacgaccgcttcgccaactacatcgacaaggtgcgattcctggagcagcagaacaagatcctgctggccgagctggagcagctcaaaggcaagggcacgtctcgcctgggtgacctgtacgaggaggagatgcgggagctgcggcggcaggtggaccagctcaccaacgacaaggcgcgcgtggaggtggagcgggacaacctggccgacgacatcatgcggctgcgggagaagttgcaagaggagatgctgcagcgggaggaggctgagaacaccctacagtccttcagacaggatgttgacaatgcctctctggcacgtcttgatcttgagcgcaaagttgagtccctgcaagaggagattgtcttcttgaagaagcttcatgatgaggaaatccgagagctgcaggcccaactccaggaacagcacatccagattgatatggatgtttctaagcctgaccttactgctgccctgcgtgacgttcgccaacagtacgaaagcgttgctgctaagaatcttcaggaagctgaagagtggtacaagtccaaatttgcagacctctccgaagctgctaaccggaacaacgatgccctgcgccaggccaaacaggaggccaatgagtaccgcaggcagattcagtctctcacctgcgaggtcgatgctctgaagggaagcaacgaatccctggagcgccaaatgcgtgaaatggaggagaactttgctgttgaagctgctaactaccaggacactattgggcgtctgcaggacgagattcagaacatgaaggaagaaatggctcgtcatctccgcgagtaccaggacctgctgaatgtaaagatggctcttgatattgagattgccacctacagaaaactgctggagggtgaagagagcaggattaacatgcctattccaacctttgcttctttgaacctgagagaaaccaacattgagtctcagccaatggttgatactcactcaaagaggacacttctaattaagactgtcgaaactagagatggacaggttattaatgaaacttcccagcatcacgatgacttggagtaaaactgaagatgcagactcagaatgcaggagaaattcttaccagcaagatttaaaaagtccatgtcttaaaggaagaaacagctttcaagtgcctttctgcagtttttccatgagcgcaagattattatgctaggaaataggtcttagatcttgcaaactgactctccctgaaggattagagtttacaatggagtctagtttacaaatagcaatatcttgtgctgcaatactgtttttaaagtattctgaattcaataaaactgcttctttttccagcacagtatgagcaacctgtcgctacttcaataaatctttggaaaatg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]