GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-15 04:20:57, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_061732547            2682 bp    mRNA    linear   VRT 23-DEC-2023
DEFINITION  PREDICTED: Cololabis saira vimentin like (viml), transcript variant
            X2, mRNA.
ACCESSION   XM_061732547
VERSION     XM_061732547.1
DBLINK      BioProject: PRJNA1054198
KEYWORDS    RefSeq.
SOURCE      Cololabis saira (Pacific saury)
  ORGANISM  Cololabis saira
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Ovalentaria; Atherinomorphae; Beloniformes;
            Belonidae; Cololabis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_084596) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_033807715.1-RS_2023_12
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 12/20/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2682
                     /organism="Cololabis saira"
                     /mol_type="mRNA"
                     /isolate="AMF1-May2022"
                     /db_xref="taxon:129043"
                     /chromosome="10"
                     /sex="male"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /country="Japan: Fukushima"
                     /collection_date="2022-05-16"
     gene            1..2682
                     /gene="viml"
                     /note="vimentin like; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 92 Proteins"
                     /db_xref="GeneID:133452850"
     CDS             96..1481
                     /gene="viml"
                     /codon_start=1
                     /product="vimentin like isoform X2"
                     /protein_id="XP_061588531.1"
                     /db_xref="GeneID:133452850"
                     /translation="
MSYNRAAPHSSYKKMFGGVERAAARSGYSSRQYSSPVRSSRISFGLSSAPPVYAAKSSGHRLRSSAGMPRLSSDQLDFSLSDAINSEFMTNRTSEKAQMQSLNDRFASYIEKVRFLEQQNKILLAELEQLRGKGSSRVGDLYEDEMRELRRQVDQLTNEKARVEVHRDNLADDIDRLREKLQDEISQREDAESNMQSFRQDVDNAALARLDLERKIESLQDEINFLKKLHDEEMMEMQSQIHQQQHVQVEMDVAKPDLTAALRDVRLQYENLASKNLQESEDWYKSKFADLTEAAARNNDSLRVAKQEANDYRRQVQALTCEVDALKGSNEALERQMREVEENFSMETNGYQDTIGRLEEDIHNMKDEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRISTPLPNFSSMNLRETMIDLKPQFETSTTVNKKVLIKTIETRDGQVINETTQNHDDME"
     polyA_site      2682
                     /gene="viml"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
acgcctatccaggcgtactgcgcggatgctgctgaggctggggcgatctcacaccgcagcagaccactttataaaggtacagtaggaagaagaagatgtcttacaacagagcagccccgcactcatcttataagaagatgttcggcggcgtggagagggcggcggcccggagcggctactccagccgccagtactccagcccggtgcgctcctcccggatctccttcggcctctcctccgctccccccgtctacgcggccaagagcagcggccacaggctccgcagcagcgccggcatgccccggctgtcctccgaccagctggacttctccctgtccgacgccatcaacagcgagttcatgaccaaccgcaccagcgagaaggcgcagatgcagtcgctcaacgaccgcttcgccagctacatcgagaaggtgcgcttcctggagcagcagaacaagatcctgctggcggagctggagcagctgaggggcaaaggctcgtcccgcgtcggggatctgtacgaggacgagatgcgggagctgcggcgccaggtggaccagctcaccaacgagaaggcccgcgtggaagtccaccgggacaacctggcggacgacatagacaggctgagagagaagttgcaggatgagatatcccagcgggaggatgcagagtcaaacatgcagagctttagacaggatgtggacaatgctgccctcgcaagactggacctggagcggaagattgagtcactgcaggatgaaatcaacttccttaagaagctgcatgatgaggaaatgatggagatgcagagccagatccatcaacagcagcacgtgcaggttgagatggacgttgcaaagcccgacctgactgcagctctgagggatgtccgtctgcaatatgagaacctggcctccaaaaacctccaggagtcagaggattggtacaaatccaagtttgctgacctcaccgaagctgcagcccggaataatgactctttgagagtggccaagcaggaggccaatgactacaggcgccaagttcaggcacttacttgtgaggtggatgccctcaaaggatctaatgaggccttggagcgtcagatgagggaggtagaggagaatttctccatggagacaaatgggtaccaggacaccatcggccggttggaggaggacattcataacatgaaggatgagatggcccgtcacctcagagagtaccaggacctcctaaatgtcaagatggccctagacattgagatcgctacctacaggaagctgctggaaggagaggagagcagaatctccacccctctgccaaacttctcctccatgaaccttagagagacaatgattgatttaaaaccccagtttgaaacgtcaacaaccgtcaacaagaaagttctcatcaaaaccattgagaccagagatgggcaggtgatcaatgaaacaacccagaaccacgatgacatggagtgataatctcctcatctttgccaaacagccaatacaagcaataagaagagacacatttcaccctggcaacaagcaagcaaacaaacaaacaaacccacgaaaagcaaacagccttgagaagtgcctttatatgtgatgatccagcaagctgttagttgacacagactgttttttttttgctttctcttcagtcacgtttgtttagactcattgtagaactcaaacacagcatagaaagcctcactgaggtttacataaagctttctttgtcaccaaagtagtatttttgatcaatatagcatgcacaacttcaagaaacctgtatgctaaagatgtcacaattgcctgtatgcagcaataaactacgaagactttaagtcaacactgtgcctaggagtaatactttgtatactttatggtaagaacatggcattaggctctataattaacattttaacaaattcatgaactgaaaactttttattttgctagtgttaagcctgtgaaataactcatttgttttcaataacagcacatgctttacatgggtcactaatagcatgattttgaaaacatataaactaaacataaattattcttgtaaataagtggattcctataagaaaaaggaattggaaaagaaatctgatggtgaagtgagctgagttgagtagtctgataatcttcatgtaggtatttattgggatacgtatattccatgaaggtaaagtacttttcaatcactgtttactctgcaaggtccttttcaaactggtggggacacaagacagtttggaaatattcacggacttcctcagagtctttggttgatgcatctgcacttcattgcttttaacattaatgtatttaactgcacaaaggaagaaagtggactgctgcttcaagctgtgaattagattacaagaattacatcaccttctccgagacagttgtgaaaaatgctgataattcaacaataagttgaatttttgtggacaggtttatctaacaagcggccatgttagtctacagtataacacaaggcattgtcatcactgctctgctgaaggcaaacacacataaagctgttttatattaactctttgacgaatgatatatgaaataatacacagaaaattacatgttttttttttatttacagtgtctataatacataaagaataaagaaattcccaagtctgtc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]