GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-15 05:07:15, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_061233490            2020 bp    mRNA    linear   VRT 04-DEC-2023
DEFINITION  PREDICTED: Conger conger vimentin-related 2 (vimr2), mRNA.
ACCESSION   XM_061233490
VERSION     XM_061233490.1
DBLINK      BioProject: PRJNA1046555
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Conger conger (European conger)
  ORGANISM  Conger conger
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Anguilliformes; Congridae;
            Conger.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_083762) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_963514075.1-RS_2023_11
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 11/30/2023
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 6% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..2020
                     /organism="Conger conger"
                     /mol_type="mRNA"
                     /db_xref="taxon:82655"
                     /chromosome="3"
     gene            1..2020
                     /gene="vimr2"
                     /note="vimentin-related 2; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 3
                     Proteins"
                     /db_xref="GeneID:133123173"
     CDS             1..1161
                     /gene="vimr2"
                     /codon_start=1
                     /product="type III intermediate filament"
                     /protein_id="XP_061089474.1"
                     /db_xref="GeneID:133123173"
                     /translation="
MAMLRVSSYRRLFEEQQWGRGNSASLMCGGQYRASARGVAAGSQWAEPDFGAARVANREAVSRYVKERTLIAALNDRLAFFIETARCLEEENECLEAEILELEETRGGLAPCAAAPVPDLGLQAVVERLRREKEQILCDTERLTKELQTLQVRHEEAAEHRTLIQLEREDVAVDVDMLCSECLALRDQVAIYEDELARLQEEQQTTIESLVEPSDGVATVTVEFPTPDVTPIISDIKEYYCQLTESLQFESQAALAVALRDQKGAGVAQISKRGEAVGVGDASKVTDVDELRKMIAELQRELAGLEKCGEELEVEIEERREAYLEEIAELQCCVEELEGSQAELNAQMSEQCADYDELLSEKMSLDMEIAAYRGLVELEEDRLCFL"
ORIGIN      
atggccatgctgagagtgtcgtcgtaccgccggctgtttgaggagcaacagtggggccgggggaatagcgcctccctgatgtgtggaggacagtatcgcgcctccgccaggggcgtagcggcaggctctcagtgggcagagcctgactttggggcggctcgggtggctaacagggaggccgtgtcccggtacgtgaaggagaggaccctgatcgcggccctgaacgaccgactggctttcttcatcgagacggctcgatgcctggaggaggagaacgagtgcctcgaggccgagatcctcgagctggaggagacgcgcggaggcctggccccctgcgccgctgccccagtgcccgacctcggcctgcaggcggtggtggagcgcctgaggagggagaaggagcagatcctgtgtgacacggagcggctgacgaaggagctgcagacgctgcaggtgcgccatgaggaggccgcggagcacaggaccctcatccagctggagagagaggacgttgccgtggatgtggacatgctgtgcagcgagtgcctggccctgagggaccaagtggccatctacgaggacgagctggcccggctgcaggaggaacagcagacgaccattgagtccctggtcgaacccagtgacggtgttgccacggtaaccgtggagttcccaacccctgacgttacccccatcatctcggacatcaaggaatactactgccagctgacagaaagtctgcagtttgagtcgcaagcagcattggccgtggcattgagggaccagaagggggccggggtggcccaaatctcaaagcggggtgaggccgtcggagtaggcgacgcctccaaagtgacggacgtcgacgagctgcggaaaatgatcgctgagctacagagggagctggcgggcctggagaagtgtggggaggagctggaggtggagattgaggagaggagggaggcgtacctggaggagatcgccgagctgcagtgctgtgtggaggagctggaggggtcccaggccgagctgaacgcccaaatgagcgagcagtgcgctgactacgatgagcttctgagtgagaagatgtctctggatatggagatcgcggcttacaggggcttggtggaactggaagaagaccggctctgcttcctgtaagaggacacaggagacgggaagttgggctgaaaccacagggagatgccctcaacatagatgggataacacagaaggaaaaaatgcaaaaaaagaatgaaaatggacaaaatccaatctctgagcatataaaaaattataaaaacagcttgagtacatatataaccccactctgacagctttacaacggcctagacagtctggctgataacagcttgctgacaggtaacttttaacgtgaacgaaaagaaaggccaccattgtgcaatgctaaggtggtagtgtaagagattttttctggatactagatgttagaatagagagctcttggagagatccaggcttatgttcataaaactggtcagagtgagattactgatctaggattagtttgcccttttagctgataatagaagaaggaaaggaaatggaccgtaggaacctgatccagtactcctattctgaggcaatgaatatgagcccagatgaacctgtgagttctctatctgtctgatagagcctttttgtccattgttatcatcttgtgtaccactgtaagcccctgtttgcagaatggtggtggccacatatgccccttgagaaaagaggggtggtcatcaccccctcatgccatcactgatagatgacatactcttaacctctccactgcccctgaggctaaccgatatcttttattcacagataagattacatggcaactgatggatctcagaccaaatactgctaatacacgtctacttaattttcaatagacgccatatatcaggatgacgcctaggcgactgcagttaggatggccatggaattttgtcatttcttcaccaaaacgtgttgcccaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]