GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-15 04:10:43, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_061178148            1804 bp    mRNA    linear   MAM 04-DEC-2023
DEFINITION  PREDICTED: Eubalaena glacialis vimentin (VIM), mRNA.
ACCESSION   XM_061178148
VERSION     XM_061178148.1
DBLINK      BioProject: PRJNA1046016
KEYWORDS    RefSeq.
SOURCE      Eubalaena glacialis (North Atlantic right whale)
  ORGANISM  Eubalaena glacialis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Whippomorpha;
            Cetacea; Mysticeti; Balaenidae; Eubalaena.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_083717) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_028564815.1-RS_2023_12
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 12/01/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1804
                     /organism="Eubalaena glacialis"
                     /mol_type="mRNA"
                     /isolate="mEubGla1"
                     /db_xref="taxon:27606"
                     /chromosome="2"
                     /sex="male"
                     /tissue_type="kidney"
                     /dev_stage="calf"
                     /country="USA: Amelia Island, Florida"
                     /lat_lon="30.591667 N 81.441667 W"
                     /collection_date="2020-03-08"
                     /collected_by="Teri Rowles, Bob Bonde"
     gene            1..1804
                     /gene="VIM"
                     /note="vimentin; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 69 Proteins"
                     /db_xref="GeneID:133081788"
     CDS             84..1484
                     /gene="VIM"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="XP_061034131.1"
                     /db_xref="GeneID:133081788"
                     /translation="
MSSRSVSSSSYRRMFGGPGTASRPSSSRSYVTTATRTYSLGSALRPGTSRSLYASSPGGVYATRSAAVRLRSSVPGVRLLQDSVDFSLADAINTEFKNTRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGQGKSRLGDLYEEEMRELRRQADQLTNDKARVEVERDNLSEDIMRLREKLQEEMLQREEAESTLQSFRQDVDNASLARLDLERKVESLQEEIAFLKKLHDEEIQELQAQIQEQHVQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQESNEYRRQVQSLTCEVDALKGTNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRIALPLPNFSSLNLRETNLDSLPLVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
     polyA_site      1804
                     /gene="VIM"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
cccaccgcgccctcgcgcgcctctcctcccggagccagcccgcgccaccgcagccgcccagcccaccgccgccctctgcagtcatgtccagcaggtccgtgtcctcgtcctcctaccgcaggatgttcggcggccccggcaccgcgagccggccgagctccagccggagctacgtgaccacggccacccgcacctacagcctgggcagcgcgctgcgccccggcaccagccgcagcctctacgcctcgtccccgggcggcgtgtacgccacgcgctccgcggccgtgcgcctgcggagcagcgtgcccggcgtgcgcctgctgcaggactcggtggacttctcgctggccgacgccatcaacaccgagttcaagaacacccgcaccaacgagaaggtggagctgcaggagctgaacgaccgcttcgccaactacatcgacaaggtgcgcttcctggagcagcagaacaagatcctgctggccgagctcgagcagctcaagggccagggcaagtcgcgcctgggggacctctacgaggaggagatgcgcgagctgcgccggcaggcggaccagctcaccaacgacaaagcccgcgtcgaggtggagcgcgacaacctgtccgaggacatcatgcgtctccgggagaagttgcaggaggagatgcttcagagggaggaagccgagagcaccctgcagtctttcagacaggatgttgacaatgcttcactggcacgtctggacctggagcgtaaagtggaatccttgcaagaagagattgcctttttgaagaaactacatgatgaggaaatccaggagctgcaggcccagattcaagaacagcacgtccaaatcgatatggatgtttccaagcccgacctcacggctgccctgcgtgacgtccgccagcagtacgagagcgtggccgccaaaaacctccaggaggctgaggaatggtacaagtccaagttcgctgacctctccgaggctgctaaccgcaacaacgatgccctgcgccaggccaagcaggagtcgaacgagtaccgtcggcaggtgcagtccctcacctgcgaagtggacgccctcaaagggaccaacgagtctctggaacgccagatgcgtgaaatggaagagaactttgccgtggaagctgctaactaccaagacactattggccgcctgcaggacgagattcagaacatgaaggaagagatggcccgtcacctgcgtgaataccaagatctgctgaatgttaagatggctctcgacatcgagattgccacctacaggaagctgctggaaggagaggagagcaggattgctctgcctcttccaaacttttcttccctgaacctgagggaaaccaatctggattcactccctctggttgacacccattcaaaaaggacgcttctgattaagacggttgaaaccagagacggacaggttatcaacgaaacttcccagcatcacgatgatctggaataaaaactgcacgtactctatgcggcaaaatactaccagtgagaataaaaaaggaatccgtatcttaaagaaacagctttcaagtgcctttctgcagttttttcaggagtgcaagatagatttgaaataggaataagctctagttcttgagaaccaacactcgtaaaagatttagaaaaaagtttacaacataatctagtttaccgaagacgccttgtgctagaatactttttaaaaagtatttttgaataccattaaaactgcttttttccatcaagtatctgaccaacttgtttctgcttcaataaatctttggaaaactc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]