2025-05-23 23:14:34, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_060926917 1401 bp mRNA linear VRT 13-NOV-2023 DEFINITION PREDICTED: Neoarius graeffei vimentin-related 2 (vimr2), mRNA. ACCESSION XM_060926917 VERSION XM_060926917.1 DBLINK BioProject: PRJNA1037146 KEYWORDS RefSeq. SOURCE Neoarius graeffei (lesser salmon catfish) ORGANISM Neoarius graeffei Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Siluriformes; Ariidae; Neoarius. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_083576) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_027579695.1-RS_2023_11 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 11/10/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1401 /organism="Neoarius graeffei" /mol_type="mRNA" /isolate="fNeoGra1" /db_xref="taxon:443677" /chromosome="8" /tissue_type="blood" /dev_stage="subadult" /geo_loc_name="Australia: Ayr" /lat_lon="19.567261 S 147.423886 E" /collection_date="2020-08-07" /collected_by="Aaron Davis" gene 1..1401 /gene="vimr2" /note="vimentin-related 2; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 Proteins" /db_xref="GeneID:132890130" CDS 18..1187 /gene="vimr2" /codon_start=1 /product="glial fibrillary acidic protein" /protein_id="XP_060782900.1" /db_xref="GeneID:132890130" /translation="
MAMLRVSSYRKLFEAEHQRPASWLSQRCGTQILPSSARGGFSTIDWPEPDFSAARALNREGLMRFSQERSIIAALNDRLAVLIDMVRCLEEENESLEAQVIEMEERSAAKPTPSSSISLNCRSDSSLEATIERLRTEKDEILCRREALTKDLHDIKIKYDEVVKQRTHFQLEREHVAMEVDTVTADCLALREQVAIYEEQLSAMKQQHELGIESVCEPPAEYQDDPAVSLKFPSIDLTPAITIIKDYYCQLAESLQFESGSVAIARGEEKGRILETSTGGKVKDYPEVMDVNGLKELIAKLQKELAELLACGEDLGAEIEAKKQAHLLEIEELETCIHRLEKEEADLQTQVKDQMEDYEELLNEKMARDIEIKAYRALVEVEEERLCCL"
ORIGIN
gtagctttggagcagccatggccatgctgagagtgtcctcatatcgcaaactgtttgaggcggagcatcagagaccagcttcatggctcagtcagcgctgtggaacccagatcctcccctcttctgccaggggtggattttccacgatcgactggcctgaaccagacttctctgcagctcgagctttaaacagagagggtctgatgcgtttctcccaggagcgctccataatcgccgccctgaacgatcgtctggcggttcttatcgacatggtacgatgtctggaagaagagaatgagtctttggaggctcaggttattgagatggaagagagatcggcagccaagccaaccccctccagctctatcagtctcaactgtcgctcagactccagcctggaggccacgattgagagactgcgcacggagaaggatgagattctgtgtcgcagagaagcgctgacgaaagacctgcacgatataaaaataaagtatgatgaggtcgtgaagcaacggactcacttccaactggaacgcgagcatgttgccatggaggtggatacggtgactgctgactgcttggcactcagagaacaagtggcaatctatgaggagcagttatctgccatgaagcaacagcatgagttggggattgagagtgtgtgtgagcctccagctgaatatcaggatgatccagctgtctctctgaaattcccctccatcgatctcactccagccatcacgattatcaaggactactactgccagctggctgaaagcctacagtttgagtccgggtccgttgcaattgccagaggagaagagaaggggaggatcttggaaacgtctactggagggaaggttaaggattatccggaggtgatggacgtgaatggtctgaaggagctgattgctaagttgcagaaggagcttgctgagctgctggcatgtggtgaagacctgggggcagaaattgaagcaaagaaacaggctcatctgctggagatcgaggagttggaaacctgcatccaccggctggagaaagaagaggctgacttacaaacacaggtgaaggaccagatggaagactatgaggaactgctcaatgagaagatggcacgggacatagaaattaaagcctacagggctttggtggaggtggaggaggagagactgtgctgcctgtgagacagagaggcccagcacacaatatatgatatgatatcttgtgtattgctgctgaactattacgcatttacatcaagttgcacattttaaaaggcgtctgtatcttgtaactcctctcatcggcagtcttatcaacgacacatacggtatgggtgtattttaaagttaaaccttttctgacttgcatgataatcctaatcctgggaatggataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]