GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-10-23 02:06:03, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_060885585            1224 bp    mRNA    linear   VRT 08-NOV-2023
DEFINITION  PREDICTED: Tachysurus vachellii vimentin-related 2 (vimr2), mRNA.
ACCESSION   XM_060885585
VERSION     XM_060885585.1
DBLINK      BioProject: PRJNA1034989
KEYWORDS    RefSeq.
SOURCE      Tachysurus vachellii
  ORGANISM  Tachysurus vachellii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Siluriformes;
            Bagridae; Tachysurus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_083472) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_030014155.1-RS_2023_11
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 11/04/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1224
                     /organism="Tachysurus vachellii"
                     /mol_type="mRNA"
                     /isolate="PV-2020"
                     /db_xref="taxon:175792"
                     /chromosome="13"
                     /sex="female"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /geo_loc_name="China: Wuhan"
     gene            1..1224
                     /gene="vimr2"
                     /note="vimentin-related 2; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 3
                     Proteins"
                     /db_xref="GeneID:132856139"
     CDS             1..1170
                     /gene="vimr2"
                     /codon_start=1
                     /product="glial fibrillary acidic protein"
                     /protein_id="XP_060741568.1"
                     /db_xref="GeneID:132856139"
                     /translation="
MAMLRVSSYRKLFEEEHPRSTSWLSQRCGTQILSSSARTGVSMIDCPEPDFSAARALNRESLMRFSQERSIIAALNDRLAVLIDMVRCLEEENESLEAQIVEMEGRLAARPIASSSSSPDCPSYSSLEAVIERLRREKDEILCHKEELKKNLHHIKIKYEEVVEQRTQLQLERKDVAVEVDSVTADCLALREQATIYEEQLATMEQQHELSIESLCEPAAEDRDDPTVSLQFPSIDLTPAITVINDYYCQLAESLQFESRAVEIARGQEKRRNLEKLTGGKVKDNSEVMDVNGLKELIAKLQKELADLEACGEELEAETEAKKEAHLLEIEELETCICQLEKEEADLQAQMKEQMGDYEDLLNEKMALDIEIEAYRVLVEMEEERLCYP"
ORIGIN      
atggccatgctgagagtgtcctcataccgcaaactctttgaggaggaacatccaagatcaacttcatggctcagccagcgctgtggaacccagatcctctcctcttctgccaggactggagtttccatgatcgactgccctgaaccggacttctctgcagctcgagctttaaacagggagagtctgatgcggttctcccaggagcgctccataatcgctgcccttaatgatcgcctggcggtccttatcgacatggtacgatgtctggaagaagaaaatgagtctttggaggctcagattgttgagatggaagggagattggcagccagaccgattgcctccagctccagcagtcccgactgcccatcatactccagcctggaggctgtgattgagagactgcgcagagagaaggacgaaattttgtgtcacaaggaggagctgaagaaaaacctgcatcatataaaaataaagtatgaagaggttgtagagcaacggactcagctccaactggagcgcaaggatgttgccgtggaggtagattcagtgactgctgactgcttggcactaagagaacaagcaacgatctatgaggagcagttagctaccatggagcaacagcatgagttgagtattgagagtctttgtgagcctgcagctgaagatcgggatgatccgaccgtatctctgcaattcccctccatcgacctcactccagccatcacggttatcaacgactattattgccagctggctgaaagcctacagtttgagtccagggctgttgagattgccagaggacaagagaagaggaggaacctggaaaaacttactggagggaaggttaaggataattctgaggtgatggacgtgaatggtctgaaggagctgattgctaaactgcaaaaggagctcgctgatctggaggcatgtggtgaggaactagaggcagagactgaagcaaaaaaagaggctcatctgctagagatagaggagctggaaacctgcatctgccagctggagaaagaagaggctgacttacaagcacagatgaaggaacagatgggggactatgaggatctgctcaatgagaagatggcactggacatagaaattgaagcctacagggttttggtggagatggaggaggagagattgtgctacccttaagacatacaatatcttgtgtattgctgctgaactaacagacttacatcaaattgc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]