GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-15 05:00:52, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_060870065            1826 bp    mRNA    linear   VRT 08-NOV-2023
DEFINITION  PREDICTED: Tachysurus vachellii vimentin (vim), mRNA.
ACCESSION   XM_060870065
VERSION     XM_060870065.1
DBLINK      BioProject: PRJNA1034989
KEYWORDS    RefSeq.
SOURCE      Tachysurus vachellii
  ORGANISM  Tachysurus vachellii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Siluriformes;
            Bagridae; Tachysurus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_083464) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_030014155.1-RS_2023_11
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 11/04/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1826
                     /organism="Tachysurus vachellii"
                     /mol_type="mRNA"
                     /isolate="PV-2020"
                     /db_xref="taxon:175792"
                     /chromosome="5"
                     /sex="female"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /country="China: Wuhan"
     gene            1..1826
                     /gene="vim"
                     /note="vimentin; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 94 Proteins"
                     /db_xref="GeneID:132845794"
     CDS             91..1455
                     /gene="vim"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="XP_060726048.1"
                     /db_xref="GeneID:132845794"
                     /translation="
MANRSSATSRQSSSYTRIFGGERSVSARSCYSSRQQSAPARTARLSYSTVSAPPSRSARVTSANLPRLASETLDFALSSAINVEFKAHRTNEKAEMQQLNDRFACYIEKVRFLERQNKMLNTELAQFRGKGTSRVGDLYEEEMRELRRQVDELNSDKARVEVDRDNLMEDIERLREKLQEEVLQREDAENNLQVFRQDVDNATLARLDLERKVESLQEEITFLKKLHDEELVELQAQIQDQHVQIDMDIAKPDLTAALRDVRLQYETLASKNIHEAEEWYKSKFADLSEAAARNTEAIRQAKQDANEYRRQVQTLTCEVDALKGTNESLERQMGELEDNFAMESSSYQETIARMDEEIQNMKDEMARHLREYQELLNVKMALDIEIATYRKLLEGEESRIANPLPNFSSFNLRESMMETKPLIENLSKKVVIKTIETRDSQVIHESTQHHEDLE"
     polyA_site      1826
                     /gene="vim"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
cccaggaggctgtaatgagctcaagctttagaggagtggagctgctgtagtgaggaccaggtgggcgtaaaaactcaacaggactcgaaaatggcaaatcgatcctcagcaacttctcgccagtcatcttcttacacaaggatatttggtggtgagcgcagcgtctccgctcggtcctgttactccagccgtcagcaatcggctccagcgcgcacagcgcgtctctcctacagcaccgtctccgctccgccgagcagaagtgcgcgagtgacaagcgcaaacttgccccgactcgcatccgaaacgttggacttcgccctgtccagtgccatcaacgtcgaattcaaagcgcaccggacaaacgagaaagccgagatgcagcagctaaacgaccgctttgcgtgctacatagagaaggtgcgctttctagagcggcagaacaagatgctgaacaccgagctggcgcagttcagaggaaaaggaacatccagagtcggagatctttatgaggaggagatgagagagttacgaaggcaagtggacgaactcaacagtgataaggccagagtcgaagtggaccgagataatttgatggaggatatcgaacgcctaagagaaaagcttcaagaagaggtccttcaaagggaagatgctgaaaacaacctccaggttttcagacaggatgttgataatgcaaccctggctcgtctagacttggagcgcaaggtggagtccctacaggaggagattactttcctgaagaaacttcatgatgaggagcttgttgagctgcaggcccagatacaagaccagcatgtgcagattgatatggacatagcaaagcctgatctgaccgctgcactgcgagatgtccgccttcagtatgagactctggccagcaagaacatccatgaggctgaggaatggtacaaatctaagtttgcagatctgtcagaggctgctgctcgtaacactgaagccatccgccaggccaaacaggatgctaatgaatatcgccgccaggtgcagactttaacctgtgaggtggatgcacttaagggcactaatgagtctctggaacgccaaatgggggaactggaggacaattttgccatggagtcctctagttaccaggaaaccatcgctcgtatggatgaagagatccaaaacatgaaggatgagatggctcgtcacttgcgtgagtaccaagaactgctgaatgtcaaaatggccctggacattgagattgcgacctacaggaagctgctggagggagaggagagcaggattgccaatccactgcccaatttttcctcttttaatttgagagaatccatgatggaaaccaaaccacttattgagaacctgtccaagaaagtggtgattaagactatagaaacaagagatagtcaagtgattcatgagtctactcagcatcatgaagacctggagtgaactgcatacaaaacctttaaaagaaaagctcacaaagaaggagagctctgtagggagaggtgatatacagtaccagaggagtatttttgtttctgtgacattaaaacagctttaatgtgcctttttgccactctagatcagcaggtagagaggtgttttatataatatagaggttgtaggctagtggaaaccaacttcacacacaattgttatagattacactgtgcaaattagaccccagcaataatcttagctatattgatttgcactgtttttttggtcagcttccagcttgaccaaaatgtagaagaatgaatgaatatatttcttaaaacaaacaaacaaacaaacaaataaacaaagttaataaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]