GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-23 22:59:36, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_060044853            2255 bp    mRNA    linear   VRT 03-OCT-2023
DEFINITION  PREDICTED: Gadus macrocephalus vimentin (vim), transcript variant
            X1, mRNA.
ACCESSION   XM_060044853
VERSION     XM_060044853.1
DBLINK      BioProject: PRJNA1018584
KEYWORDS    RefSeq.
SOURCE      Gadus macrocephalus (Pacific cod)
  ORGANISM  Gadus macrocephalus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Zeiogadaria; Gadariae; Gadiformes; Gadoidei;
            Gadidae; Gadus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_082404) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_031168955.1-RS_2023_09
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 09/26/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2255
                     /organism="Gadus macrocephalus"
                     /mol_type="mRNA"
                     /db_xref="taxon:80720"
                     /chromosome="23"
     gene            1..2255
                     /gene="vim"
                     /note="vimentin; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 4 long SRA reads, 98
                     Proteins"
                     /db_xref="GeneID:132452301"
     CDS             168..1562
                     /gene="vim"
                     /codon_start=1
                     /product="vimentin isoform X1"
                     /protein_id="XP_059900836.1"
                     /db_xref="GeneID:132452301"
                     /translation="
MMSNRSSNSSRPIAASSYSRMFSAERPAASRTSYSSRQYSSPAVQRSTARSSYSVSSAPQQGMYASKNVRLRSAHMPRLSSDAVDFSLSEAINTEFKTNRTNEKAQMQHLNDRFASYIDKVRYLEQQNKMLSTELEQLKGQGKSRIGDLYEDEMRELRKQVDQLTNEKSQVEVDRDNLGDDVERLRQKLQEEMLQKEDAEHNLQTFRQDVDNASLARLDLERKIESLQEEIMFLRKIHEEELADLQAQLQDQHVQIEMDVVKPDLTAALRDVRQQYESLATKNLHESEEWYKSKFADLADQQQRNGDSLRLSKTEANEYRRQVQALTCEVDSLRGTNESMERQMRELEDNFGAEAGGYQDNIVQLEDDIRNMKDEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRITTPLPTFSSLNMRETMMESRPMVDHTKRVVIKTIETRDGHVINESTQQHDDQE"
     polyA_site      2255
                     /gene="vim"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
gggactataaaaaccaagtggaagtcaggacagagctctcactggtcttggaatatcagttgctggagcgcctgcagactgtactatcctacccatcgcaactttgagcccactttgaggtgttataaaaagggcgtactccaggagtcggattgaaaaccgcaaaaatgatgagtaatcggtcaagcaacagcagtaggcctatcgccgcctcctcctactccaggatgttcagcgcggagcgccccgccgcgtcgcgcacctcctactccagccgccagtactccagcccggcggtgcagcgctccaccgcccgctcgtcctacagcgtctcctcggcgccccagcagggcatgtacgcctccaagaatgtccgtctgcgcagcgcccacatgccgcgtctctcatcggacgccgtggacttctcgctgtccgaggccatcaacacggagttcaagaccaacaggaccaacgagaaggcgcagatgcagcacctcaacgaccgcttcgcaagctacatcgacaaggtgcgctacctggagcagcagaacaagatgctgagtaccgagctggagcagctcaagggccagggcaagtcccgcatcggggatctgtacgaggacgagatgcgtgagctgcgcaagcaggtggaccagctgaccaacgagaagtcgcaggtggaggtggaccgcgacaacttgggcgacgatgtcgaacgcctgcgacaaaagctacaggaggagatgctgcagaaggaggacgcagagcacaacctccagacctttagacaggatgtggacaatgcctctctggcccgtctagaccttgagaggaagattgagtctcttcaggaggagatcatgttcctcaggaaaatccatgaagaggagctggccgacctgcaggcccagctccaggaccagcacgtccagatcgagatggacgtggtcaagcccgacctcaccgccgccctgcgggacgtccggcagcagtacgagtccctggccaccaagaacctgcacgagtccgaggaatggtacaagtctaagtttgcagacctcgccgaccagcagcaacgcaacggagactccctccggctgtccaagacggaggccaacgagtacagacgccaggtgcaggcgctcacctgcgaggtggactccctcagaggaaccaatgaatccatggaacgccagatgcgcgagctggaggacaacttcggagcagaggctggcggttaccaggacaacatcgtccagctggaggacgacatccgcaacatgaaagacgagatggcccgccacctcagagagtaccaggacctgctgaacgtcaagatggccctggacatcgagatcgccacctaccgcaagctgctggagggagaggagagcaggattaccactccattgcccaccttttcttcccttaatatgagagaaaccatgatggagagccggcctatggtagaccacaccaagagggtcgtgattaagaccatcgagacccgagatggacacgtaatcaatgagtcaacccagcaacacgacgaccaggaatgagatcaactcgactgaaccactaaggagagatggggggagacaagagaaagggcgaaagggcggtggatacaaagaaatacatttgaagcatgaagactaacaaaatgataatgatatgcggcaaacggggatatattgatgttgtgttagtgaaagttaaaaataaaaagaacatcttaaaaagtgccttttaaaagtgacacattttaggggcattgggttgctagtaaggttgttctaggctaggaaacagtagaagataagatagtcactgaatgtagaggaggaggaggtaatcctgcgctgaatgagcacattctctccggcgttctctcttgtagcttctgtaccacatttactccaccagcacaaagcgctagctattcaaatggctttccacaagaaccacacgtatctatctttaagttcttattcactctagtatatatgttgcgaggggcgcaatcatttgcaataaaaatctgaccagagaaaatggcttattttcaaatcatctacaacacgtgtttaaaatcggtgtggttgttttcgttttaaggcttcaatggatccaccacatataaagagatacggttctggactgcagcaataatgcactcaaagccatgatgaacatgtcactactactgtaccgttctgtatgacgtcaataaatactttcagtggaatatc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]