2024-10-23 02:06:02, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS XM_059515739 1671 bp mRNA linear VRT 14-SEP-2023 DEFINITION PREDICTED: Carassius carassius vimentin-related 2 (vimr2), mRNA. ACCESSION XM_059515739 VERSION XM_059515739.1 DBLINK BioProject: PRJNA1013068 KEYWORDS RefSeq. SOURCE Carassius carassius (crucian carp) ORGANISM Carassius carassius Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Cyprinidae; Cyprininae; Carassius. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_081783) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_963082965.1-RS_2023_09 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 09/07/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1671 /organism="Carassius carassius" /mol_type="mRNA" /db_xref="taxon:217509" /chromosome="29" gene 1..1671 /gene="vimr2" /note="vimentin-related 2; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 Proteins" /db_xref="GeneID:132109560" CDS 268..1419 /gene="vimr2" /codon_start=1 /product="vimentin" /protein_id="XP_059371722.1" /db_xref="GeneID:132109560" /translation="
MALLRVSSYRKLFEEEQWSQAAGRCGVQVRFNARGGVSVRECPELDFAAARALNKEGVARFVSERSVIAGLNDRLAGLIDVVRCLEEENESLEAEILELEEMLESEQISTSTVSISGPVDYSLEAVIERLRKEKELILCNTEELKGELRRLQMKYDQVVEHKRLLQQEREDVSVEVDAITTDCLALREQVAIYEEQLAAMDRQHETRLGKLCEPMTLDEGSPTVSLQFPSFDISPAIMDIKEYYGTLAESLKFEFRASSAAGKEEEQLAKLIGGEVKDVSKETDVNVLKNLIAELQKEVTELEKHGDELEAEIEGRKTKYLEEIEELENYICQLEEEEADLRFQMKDQSGDYEELLNQKMNLDIEIAAYRGLVEEEEERLSCL"
ORIGIN
tattattattattattgctcaaataagtaatgctagtgcaacctctgtcattgtcccagtataactgctttctgaaggagtggcctccaatctctaaattgtttatgctccatgtgaaaggtttattttctgacgctgttgctctagttagtacaccttgtgttcagtgagagatcccacaagtgcctgtgacattctcagcacctgcgtctataaagagccccggtttgcgcagtggtcatctcttcttgctgtcctgctgctgtcatggccctgctgagagtgtcttcctaccgtaaactgtttgaggaggagcagtggagccaggctgcaggacgctgtggagtccaggtccgcttcaatgccaggggtggagtttcagtgcgtgaatgtcccgagctggattttgctgcagctcgtgccctaaacaaggagggtgtggcacgatttgtcagtgaacgctctgtcatcgccggcctcaacgatcgcctggccggcctcatcgacgtggttcggtgtctagaagaggagaatgaatctctggaggcagagattcttgagctggaggaaatgctggagtcggagcagatctccaccagcaccgtcagcatcagcggtcctgtggactacagtttagaggctgtgatagagaggctacggaaagagaaggagctgattttatgcaacactgaggagctgaagggtgagctgcggcgtctgcagatgaaatacgatcaggttgttgagcacaagagactcctccagcaagagcgagaagatgtttctgtggaggtggatgcaattaccactgactgcctggcccttcgagagcaagtggccatctatgaggagcagctggccgccatggacaggcagcacgaaacgaggctggggaaattgtgtgagcccatgactctggatgaaggttctcctactgtatccctgcagttcccctcctttgatatctctccagccatcatggacatcaaggagtactatggcacactagctgagagcctcaagtttgagttcagagcctcgagcgctgcaggaaaggaggaggagcagctggctaagttgattggaggggaagtgaaggacgtctccaaagagactgatgtgaatgtcctcaagaacttgattgcagagctgcagaaagaagtgacagagctggagaagcatggagacgagttggaggctgaaatagaaggcaggaaaaccaaataccttgaggagatagaggagctggagaattacatttgtcagctggaggaggaggaggctgatcttcggttccagatgaaggatcagagtggggactatgaagaactgctgaaccagaagatgaatctagacatagagatagctgcttacaggggtttggttgaagaagaagaagagagactgagctgcctgtaagctgcaagaagaggtgatgctctcttctggactgaagcagacacaaagaaacactaaaaccacatacaattcaacccttaacagcaagtctcacaaatcaagaaagtaaagaaaacagctgtcagacacacttaaccttctgagcagatgtaaaccttcactgacagatgaacttcagggagttcgtggaagctcattgataacgggtcagtggcaggtaaccccgggtcttcaagaaacactggatctgtg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]