GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-15 04:56:53, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_059346605            1167 bp    mRNA    linear   VRT 01-SEP-2023
DEFINITION  PREDICTED: Centropristis striata vimentin-related 2 (vimr2), mRNA.
ACCESSION   XM_059346605
VERSION     XM_059346605.1
DBLINK      BioProject: PRJNA1009836
KEYWORDS    RefSeq.
SOURCE      Centropristis striata (black sea bass)
  ORGANISM  Centropristis striata
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Perciformes; Serranoidei; Serranidae;
            Serraninae; Centropristis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_081528) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_030273125.1-RS_2023_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/29/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1167
                     /organism="Centropristis striata"
                     /mol_type="mRNA"
                     /isolate="RG_2023a"
                     /isolation_source="ocean"
                     /db_xref="taxon:184440"
                     /chromosome="12"
                     /tissue_type="muscle, liver"
                     /ecotype="Rhode Island"
                     /country="USA: Rhode Island coast"
                     /lat_lon="41.319322 N 71.500169 W"
                     /collection_date="2021-08-04"
     gene            1..1167
                     /gene="vimr2"
                     /note="vimentin-related 2; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 1
                     Protein"
                     /db_xref="GeneID:131982050"
     CDS             1..1167
                     /gene="vimr2"
                     /codon_start=1
                     /product="neurofilament medium polypeptide"
                     /protein_id="XP_059202588.1"
                     /db_xref="GeneID:131982050"
                     /translation="
MAMLRVSSYRKLFEDERWSRSGGMSMQCAGQSRVPVRGAADCDCDKLDFVAAKALNEEGLNRFVQDRNIISALNDRLVRLIELAHCFEEENESLECQIVELEEKLNSRAASSSVSAAQPDPDYSLDSVVERLRRERDEILCDTEELHKELELLMKEYEKAAQQRILLQQGRQDVAEEVDAVTAECLALREQVAIYEQQLANMEAQHTTEVQSLVEPAEGTTGAVAAITFGSPDISRALDVKEYYCQLAESLQFECGAASSAVVRPGDGKQLEVGGAAGSAVKDVSKIKDVSELEMLLSELQKELAELEKYNEELEDEVEMKKAAYMDEIAELKCTIEEMQQQEADFHVQMKEQCEDYRVLLSEKMARDMEITAYRSLVEEEEERLCCL"
ORIGIN      
atggccatgctcagagtgtcttcttatcgcaagctgtttgaggatgagaggtggagtcggagcggagggatgagtatgcagtgtgcggggcagtcccgtgtccctgtcaggggtgcggccgactgtgactgtgacaagttagactttgtcgctgccaaggctcttaacgaggagggtctgaaccggtttgtccaggaccgcaacatcatctctgccctcaacgaccgcctggtcagacttattgaactggctcattgtttcgaggaggagaacgagtcccttgaatgtcagattgttgaacttgaggagaagctgaacagtcgagcagcttcctccagcgtcagcgccgctcagcccgaccctgactacagtctggattcagtggtggaacgactgcgcagagagagggatgagattctgtgtgacactgaggagctgcacaaagagctggagcttctgatgaaggagtatgagaaagctgcacagcagaggatcctcctgcagcagggccgacaagatgtcgctgaggaagtcgacgctgtgacagcagagtgtttggcgctgagggagcaagtggctatctacgagcagcagctggccaacatggaggcccagcatacaacggaagtgcagagtctggtggagccggctgaagggacaacaggagcggtggcagctattacatttggcagccctgacatcagccgggctctggatgtaaaggagtactactgccagctggctgagagcctccagttcgagtgtggtgcagcctcctccgctgtggttcgccctggtgatggaaaacaactggaagtgggaggagctgcagggtcagcagtcaaagacgtgtcaaagataaaggacgtcagcgagctggagatgctgctttcagagctacagaaggagctggctgagctggagaagtataatgaggagctggaggacgaggtcgagatgaagaaggctgcatacatggacgagattgctgagttgaagtgtactatagaggaaatgcagcagcaggaggccgatttccacgtgcagatgaaggagcagtgtgaagactacagggtgctgctcagtgagaagatggccagagacatggagatcaccgcctacaggagtctggtggaggaagaggaggagaggctgtgctgcctgtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]