GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-24 00:20:54, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_058765021            1908 bp    mRNA    linear   VRT 08-AUG-2023
DEFINITION  PREDICTED: Onychostoma macrolepis vimentin (vim), mRNA.
ACCESSION   XM_058765021
VERSION     XM_058765021.1
DBLINK      BioProject: PRJNA999377
KEYWORDS    RefSeq.
SOURCE      Onychostoma macrolepis
  ORGANISM  Onychostoma macrolepis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Cyprinidae; Acrossocheilinae; Onychostoma.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_081178) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_012432095.1-RS_2023_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/02/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1908
                     /organism="Onychostoma macrolepis"
                     /mol_type="mRNA"
                     /isolate="SWU-2019"
                     /db_xref="taxon:369639"
                     /chromosome="24"
                     /sex="female"
                     /tissue_type="muscle"
                     /dev_stage="adult"
     gene            1..1908
                     /gene="vim"
                     /note="vimentin; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 108 Proteins"
                     /db_xref="GeneID:131533035"
     CDS             136..1503
                     /gene="vim"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="XP_058621004.1"
                     /db_xref="GeneID:131533035"
                     /translation="
MASRTNASSYKRMFGGERPAILRSAYTSRQYSSPVRTTSRVTYSGSSSASPSIYMSKSARVRSSAPMPRLTTDTLDFGLADAINIEFKANRTNEKAEMQHLNDRFASFIEKVRFLEQQNKILNAELEQMRGKGSSRIGDLYEDEMRELRSIVDQLTNEKARVEVDRDNLGEDIERLKEKLQEEMLQREDAENTLRGFRQDVDNASLARLDLERKVESLQEEIAFLKKLHDEELADLQIQIQEQHVQVDMEVSKPDLTAALKDVRQQYETLASRNLQESEDWYKSKFADLSEAAARNNEAIRLAKQEANDYRRQLQALTCDLESLKGTNESLERQMREIEDNFSMEASSYQDTIARLEDDIHNMKDEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRITTPFPNFSSLTLRESMKETRPAMDSLSKKVVIKTIETRDGHIINESTQNDDLE"
     misc_feature    148..411
                     /gene="vim"
                     /note="Intermediate filament head (DNA binding) region;
                     Region: Filament_head; pfam04732"
                     /db_xref="CDD:461414"
     misc_feature    412..1338
                     /gene="vim"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:459643"
ORIGIN      
tatgtcattagcatagggagtggactataaatgcaagcagaatcgctgcagtggtctcgtttggtctggacagggcgcggtagttcgtgaaagtagacgttgacttcaacaataccccagaactaaaggattacaatggccagccgcacaaacgcatcttcttacaaaaggatgttcggtggagagcgaccagcgattcttcggtccgcttacaccagccggcagtacagcagcccggtgcgcacaacctcgcgcgtgacctacagcggctcgtcctccgcgtctccatccatctacatgagcaagagcgcgagggtgcgcagcagcgcgccgatgcccagactcaccaccgatacgctggacttcgggctcgcagatgccatcaacatcgagtttaaagccaaccgaaccaatgagaaagcggagatgcagcatctcaacgacaggtttgccagtttcatagagaaagtgagatttctggagcagcagaataagatcttgaacgcggagctggagcagatgcggggcaaaggctcgtcccggatcggtgatctgtacgaggatgagatgagagaactccggagtatagtggaccagctcaccaacgagaaggccagagtggaggtggaccgggacaatctgggagaggacatcgagcgcctcaaagagaaacttcaagaagagatgctccagagagaggatgcggagaacacccttcggggcttcagacaggatgttgataacgcctccctggctcgtctggacctggagagaaaggtggagtccttgcaagaagaaatcgctttcttgaagaagcttcatgatgaggaacttgccgatctgcagattcagatccaggaacagcatgtgcaggttgatatggaagtgtccaaacctgacctcaccgctgccctgaaagatgtccggcagcagtacgagactctggcttccaggaacctccaggagtctgaggactggtacaaatccaagtttgctgacctgtcagaagctgctgcccgtaacaatgaagcgatccgtctggccaagcaggaggccaatgactatcgccgccaacttcaagctctcacctgcgacttagaatctcttaaaggaactaatgagtccctggagcgtcagatgagagagatagaagataacttctccatggaggcatccagttaccaggacaccatcgctcgtctagaggacgacatccacaacatgaaggatgagatggcgcgtcatctacgtgaataccaggatctgctgaacgttaaaatggccctggatattgagatcgccacctacaggaagctgctggaaggggaagaaagcaggatcaccacaccatttcccaatttctcatcattaaccctgcgagagtccatgaaggaaaccagacctgcgatggacagcctgtcaaagaaagtggtgataaagaccatcgagaccagagacggacatataataaacgagtccacccaaaatgatgatctggaatgagccgcatgtgaacatgtgactagtaggggcaccagagagctgaagacccatgctggagtagaacgagaaggaatggagtttcttttgttgtttctgttgagagtaaaaaagaaaaacagctttaaagtgccttttttgcattgccacattagagcagtctgtcgatagagctgtattagagctgaaaagataacgtaggccactgaataaaccagctttatccaggtttatgtttaccacgatgtctgtagtttacactgttgaagaccacagcaatactgctacacctttttctgttttgtataattattgcaaatgaccaaaaacttgatgaactcgtctctcttgcaccataagaagaccaaactgtcaacaaatttccacaaattcaataaaccttttaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]