GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-19 08:47:32, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_057237068             879 bp    mRNA    linear   PLN 12-JUN-2023
DEFINITION  Penicillium soppii uncharacterized protein (N7529_001537), partial
            mRNA.
ACCESSION   XM_057237068
VERSION     XM_057237068.1
DBLINK      BioProject: PRJNA973687
            BioSample: SAMN30185374
KEYWORDS    RefSeq.
SOURCE      Penicillium soppii
  ORGANISM  Penicillium soppii
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae;
            Penicillium.
REFERENCE   1  (bases 1 to 879)
  AUTHORS   Petersen,C., Sorensen,T., Nielsen,M.R., Sondergaard,T.E.,
            Sorensen,J.L., Fitzpatrick,D.A., Frisvad,J.C. and Nielsen,K.L.
  TITLE     Comparative genomic study of the Penicillium genus elucidates a
            diverse pangenome and 15 lateral gene transfer events
  JOURNAL   IMA Fungus 14 (1), 3 (2023)
   PUBMED   36726175
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 879)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (09-JUN-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 879)
  AUTHORS   Petersen,C.
  TITLE     Direct Submission
  JOURNAL   Submitted (10-JAN-2023) Department of Chemistry and Bioscience,
            Aalborg University, Fredrik Bajers Vej 7H, Aalborg, Nordjylland
            9220, Denmark
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_026643232).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..879
                     /organism="Penicillium soppii"
                     /mol_type="mRNA"
                     /strain="IBT 18220"
                     /culture_collection="IBT:18220"
                     /db_xref="taxon:69789"
                     /chromosome="Unknown"
     gene            <1..>879
                     /locus_tag="N7529_001537"
                     /db_xref="GeneID:81888847"
     CDS             1..879
                     /locus_tag="N7529_001537"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_057101755.1"
                     /db_xref="GeneID:81888847"
                     /translation="
MESAEECAAKCGEGCPGAVWEYTKNNCIIYDSPVTLTPHGRGSIYLKPIQGAQDNGEESSSTSECLHEKQACEDELTHQLGISSRCQSEKEALALESQQCQERNDDLDAQSKTCQRERDGIGTKLQDCNWQKDGLETENKSCKREKDELDTKSKTCQREKDELDTKSKTCQREKDELDTKSKTCQREKDELDSNWKAKYEKEVNGVPLKGSYGAVLPGFYWAPNPIIIGKFPGVGTGIWQLCANACEKDTSCRASVADYSTGTCYKTRMPAGGFTTKHLQDSIGGRYGSYVK"
     misc_feature    <250..>579
                     /locus_tag="N7529_001537"
                     /note="RecF/RecN/SMC N terminal domain; Region: SMC_N;
                     cl47134"
                     /db_xref="CDD:481474"
ORIGIN      
atggagtcggcagaggaatgtgctgctaaatgtggtgaaggatgccctggtgctgtatgggagtacactaagaacaattgcattatctatgactctcctgtcactctgactccccatgggcggggctctatctacttgaagcctatccaaggggctcaagataatggagaagaaagctcttccacttcggaatgtctccatgagaaacaggcctgtgaggatgaacttacgcaccaactgggaatatcgagcagatgtcagtccgagaaagaggccctagcactcgaaagtcaacagtgtcaggaaagaaatgatgatcttgacgcccagagtaagacctgtcagcgtgagagagacggcattggtaccaaacttcaagactgcaattggcagaaggatggattagaaacggagaacaagtcttgtaaacgggagaaagatgagttggacacaaagagcaagacttgccaacgagagaaggacgagctggacaccaagagcaagacctgccaacgagagaaagacgagctggacaccaagagcaagacctgccagcgggagaaagatgaactagactcgaactggaaagcgaagtatgaaaaggaagtcaatggtgttcccctaaagggttcctatggagcagttcttcccgggttttactgggctccgaaccccataataatcggaaaattccccggagttggaaccggaatttggcagctatgcgccaatgcatgcgagaaagatacaagctgcagggcttcagttgcggattattctactggtacctgctacaaaaccagaatgccagctggcggttttacgacaaagcatcttcaagacagtattggtggaaggtacggttcttacgtcaaatag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]