GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-24 00:07:39, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_056114551            1805 bp    mRNA    linear   MAM 09-OCT-2023
DEFINITION  PREDICTED: Sorex fumeus vimentin (VIM), mRNA.
ACCESSION   XM_056114551
VERSION     XM_056114551.1
DBLINK      BioProject: PRJNA972655
KEYWORDS    RefSeq.
SOURCE      Sorex fumeus (smoky shrew)
  ORGANISM  Sorex fumeus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Eulipotyphla; Soricidae;
            Soricinae; Sorex.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_026606083) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_029834395.1-RS_2023_10
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 10/04/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1805
                     /organism="Sorex fumeus"
                     /mol_type="mRNA"
                     /db_xref="taxon:62283"
                     /chromosome="Unknown"
     gene            1..1805
                     /gene="VIM"
                     /note="vimentin; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 36 Proteins"
                     /db_xref="GeneID:130023954"
     CDS             86..1489
                     /gene="VIM"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="XP_055970526.1"
                     /db_xref="GeneID:130023954"
                     /translation="
MSTRSVSSSSYRRMFGGPGSSSSRPSASRSYVTTSTRTYSLGSSLRPSTSRSLYGASPGGAYATRSSAVRLRSAGPGLRMLHDSVDFSLADAINTEFKNTRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGQGKSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLSEDIMRLREKLQEEMMQREEAESNLQSFRQDVDNASLARLDLERKVESLQEEIAFLKKLHDEEIQELQAQIQDQHVQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQESNEYRRQVQSLTCEVDALKGTNESLERQMREMEENFAMEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRIALPLPSFASLNLRETNLESLPLVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
     misc_feature    182..391
                     /gene="VIM"
                     /note="Intermediate filament head (DNA binding) region;
                     Region: Filament_head; pfam04732"
                     /db_xref="CDD:461414"
     misc_feature    392..1318
                     /gene="VIM"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:459643"
     polyA_site      1805
                     /gene="VIM"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
cgaagtcccgtcctctgcgctccctcgctccgggtccccacgcccgattcgcagccgccgctcccagccaccgcgccccgcagccatgtccaccaggtccgtgtcctcgtcgtcctaccgcaggatgttcggcggcccgggcagctcgagcagccggccgagcgccagccgtagctacgtgaccacgtccacccgcacctatagcttgggcagctcgctgcgccccagcaccagccgcagcctgtacggcgcgtcccccggcggcgcgtacgccacccgctcgtccgccgtgcgcctgcggagcgccgggcccgggctgcggatgctgcacgactcggtggacttctcgctggccgatgccatcaacaccgagttcaagaacacgcgcaccaacgagaaggtggagctgcaggagctcaacgaccgcttcgccaactacatcgacaaggtgcgcttcctggagcagcagaacaagatcctgctggccgagctcgagcagctcaagggccagggcaagtcgcgcctgggggacctgtacgaggaggagatgcgggagctgcgccggcaggtggaccagctcaccaacgacaaggcccgcgtggaggtggagcgcgacaacctgagcgaggacatcatgcggctccgggagaagttgcaggaggagatgatgcagagagaggaagccgagagcaacctgcagtccttcagacaggacgtggacaatgcttctctggcacgtctggaccttgaacgcaaagtggaatcattgcaggaagaaatcgccttcttgaagaaactgcatgatgaagagatccaggaactgcaggcgcagattcaggaccagcatgtgcagatcgacatggatgtgtccaagcctgacctcacggcagccctgcgtgacgtgcgtcagcagtacgagagcgtggccgccaagaacctgcaggaggctgaggagtggtacaagtccaagtttgctgacctctctgaggctgccaaccgcaacaacgatgccctgcgccaggcaaagcaggagtccaatgagtacaggagacaagtgcagtccctcacctgcgaagtggatgctctgaaaggaactaatgagagtctggaacgtcagatgcgggaaatggaagagaactttgctatggaagctgccaactaccaagacactattggccgtctgcaggacgagattcagaacatgaaggaggagatggctagacacctccgtgaataccaggacctgctgaatgttaagatggctcttgacattgagattgccacctaccggaagctgctggaaggcgaggagagcaggattgctttgcctcttcccagctttgcttccctgaacctgagagaaaccaatctggagtccctccctctggtggacacacactccaagagaacacttctgattaagaccgttgagacccgagatggacaggttatcaacgaaacttcccagcatcatgatgacctggagtgaaaatctcagccatctggtgcagcagtttcttaccagcagaataagaaagatccatatcataaaggaaacagctttccaagtgccttttctgcagttttttaagagcgcaagatagatttggaataggaataagctagtacttaagaaccaacatttgtaaaagatgtagacaaaaagtttacaacctaatctagtttatgaagacaacttgtgctagaatacttttcttaaaaagtatttttgaataccattaaaactgctttttttccgaacaactctgaccaacctgtctctgaataaatctttgggaaactca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]