GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-15 05:03:58, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_056029671            2181 bp    mRNA    linear   INV 10-MAY-2023
DEFINITION  PREDICTED: Biomphalaria glabrata protein starmaker-like
            (LOC106060130), mRNA.
ACCESSION   XM_056029671
VERSION     XM_056029671.1
DBLINK      BioProject: PRJNA962856
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Biomphalaria glabrata
  ORGANISM  Biomphalaria glabrata
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Heterobranchia; Euthyneura; Panpulmonata; Hygrophila; Lymnaeoidea;
            Planorbidae; Biomphalaria.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_074715) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_947242115.1-RS_2023_05
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 05/01/2023
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..2181
                     /organism="Biomphalaria glabrata"
                     /mol_type="mRNA"
                     /db_xref="taxon:6526"
                     /chromosome="5"
     gene            1..2181
                     /gene="LOC106060130"
                     /note="protein starmaker-like; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 5
                     Proteins"
                     /db_xref="GeneID:106060130"
     CDS             1..2181
                     /gene="LOC106060130"
                     /codon_start=1
                     /product="protein starmaker-like"
                     /protein_id="XP_055885646.1"
                     /db_xref="GeneID:106060130"
                     /translation="
MAQRTPNILLLKEHQTFYGSKNTSHSKAQRPPDILWLKNTRHSITQRTPDILLLKEHQTFYGSKNTRHSITQRTPNILWLKEHQTFYGSKNTRHSMAQRTPDIKWLLIVRDSCRSLACRNPRPKGKIPLEPGELDKDEQELDKDKQELDKDEQELDKDEQELDKDELESDKDEQESDKDDQELDKDDQELDKDEQELDKDEQQLDKDEQELDKDELESDKDEKELDLDDQELDKDEQELDKDEQELDKDEQELDKDEQELDKDELESDKDEQESDKDEQESENDEQELDKDDQELDKDEQELDKDELELDKDELESDKDEQESDKDEQESDKDEQESDKDEQESDKDEQELDKDDQELDKDEQELDKDEQESDKDEQESDKDEQESDKDDQESDKDEQELDKDEQELDKDEQELDKDEQELDKDEQELDKDEQELDKDEQELDKDELESDKDEKELDLDDQELDKDEQELDKDEQELDKDELESDKDEQESDKDEQESDNDEQELDKDDQELDKDDQELDKDEQELDKDELESDKDELESDKDEQESDKDEQESDKDEQESDKDEQESDKDEQESDKDEQESDKDEQESDKDDQELDKDEQESDKDEQESDKDEQESDKDEQELDKDEQELDKDEQELDKDDQESDKDEQESDKDDQESDKDDQELDKDEQELDKDDQELDKDDQELDKDEQELDKDEQELDKDDQELDKDDQELDKSDKKLEEVD"
     misc_feature    <403..2178
                     /gene="LOC106060130"
                     /note="Midasin, AAA ATPase with vWA domain, involved in
                     ribosome maturation [Translation, ribosomal structure and
                     biogenesis]; Region: MDN1; COG5271"
                     /db_xref="CDD:444083"
ORIGIN      
atggctcaaagaacaccaaacattctattactcaaagaacaccagacattctatggctcaaaaaacaccagtcattctaaggctcaaagaccaccagacattctatggctcaagaacaccagacattctattactcaaagaacaccagacattcttttgctcaaagaacatcagacattctatggctcaaagaacaccagacattctattactcaaagaacaccaaacattctatggctcaaagaacaccagacattctatggctcaaagaacaccagacattctatggctcaaagaacaccagacattaaatggcttttgatcgtaagggacagctgcagatctcttgcttgcagaaatccgagacccaaaggaaagattcctctagagccaggcgagttagacaaggatgagcaggagttagacaaggataagcaggagttagacaaggatgagcaggagttagacaaggatgagcaggagttagacaaggatgagctggagtcagacaaggatgagcaggagtcagacaaggatgaccaggagttagacaaggatgaccaggagttagacaaggatgagcaggagttagacaaggatgagcagcagttagacaaggatgagcaggagttagacaaggatgagctggagtcagacaaggatgagaaggagttagacttggatgaccaggagttagacaaggatgagcaggagttagacaaggatgagcaggagttagacaaggatgagcaggagttagacaaggatgagcaggagttagacaaggatgagctggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagtcagaaaatgatgagcaggagttagacaaggatgaccaggagttagacaaggatgagcaggagttagacaaggatgagctggagttagacaaggatgagctggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagttagacaaggatgaccaggagttagacaaggatgagcaggagttagacaaggatgagcaggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagtcagacaaggatgaccaggagtcagacaaggatgagcaggagttagacaaggatgagcaggagttagacaaggatgagcaggagttagacaaggatgagcaggagttagacaaggatgagcaggagttagacaaggatgagcaggagttagacaaggatgagcaggagttagacaaggatgagctggagtcagacaaggatgagaaggagttagacttggatgaccaggagttagacaaggatgagcaggagttagacaaggatgagcaggagttagacaaggatgagctggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagtcagacaatgatgagcaggagttagacaaggatgaccaggagttagacaaggatgaccaggagttagacaaggatgagcaggagttagacaaggatgagctggagtcagacaaggatgagctggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagtcagacaaggatgaccaggagttagacaaggatgagcaggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagtcagacaaggatgagcaggagttagacaaggatgagcaggagttagacaaggatgagcaggagttagacaaggatgaccaggagtcagacaaggatgagcaggagtcagacaaggatgaccaggagtcagacaaggatgaccaggagttagacaaggatgagcaggagttagacaaggatgaccaggagttagacaaggatgaccaggagttagacaaggatgagcaggagttagacaaggatgagcaggagttagacaaggatgaccaggagttagacaaggatgaccaggagttagacaagtctgacaagaagctagaagaggttgactag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]