GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-15 05:58:48, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_051073683            3064 bp    mRNA    linear   VRT 28-FEB-2023
DEFINITION  PREDICTED: Lates calcarifer trichohyalin (LOC108877600), transcript
            variant X1, mRNA.
ACCESSION   XM_051073683
VERSION     XM_051073683.1
DBLINK      BioProject: PRJNA345597
KEYWORDS    RefSeq.
SOURCE      Lates calcarifer (barramundi perch)
  ORGANISM  Lates calcarifer
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Carangaria; Carangaria incertae sedis;
            Centropomidae; Lates.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_066843) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_001640805.2-RS_2023_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/27/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3064
                     /organism="Lates calcarifer"
                     /mol_type="mRNA"
                     /isolate="ASB-BC8"
                     /db_xref="taxon:8187"
                     /sex="male"
                     /tissue_type="Brain, Kidney"
                     /dev_stage="adult"
                     /linkage_group="LG11"
                     /note="Back-crossed individual (decreased polymorphism)"
     gene            1..3064
                     /gene="LOC108877600"
                     /note="trichohyalin; Derived by automated computational
                     analysis using gene prediction method: Gnomon."
                     /db_xref="GeneID:108877600"
     CDS             1635..2288
                     /gene="LOC108877600"
                     /codon_start=1
                     /product="trichohyalin isoform X1"
                     /protein_id="XP_050929640.1"
                     /db_xref="GeneID:108877600"
                     /translation="
MERKHREELKEKDELLNREVNKRRARTQAYVNCLDLLNRQEKALKSAELRGKALESNLRWELTLKEEKHQEEKKYKEEVEEETKRSEDGWRRMESHLREELNHKDELLKKETKKRKARTQAYVDCMNLLSQKEKDLKESEEQTHDALEKSLKLELALKDQREQEDKYKEKVEEETKRAEDELRRMESQFTEELKEKDELLNREINKRRLILRLMLTA"
     misc_feature    <1638..>2273
                     /gene="LOC108877600"
                     /note="Chromosome segregation ATPase Smc [Cell cycle
                     control, cell division, chromosome partitioning]; Region:
                     Smc; COG1196"
                     /db_xref="CDD:440809"
ORIGIN      
cttcctgttgtctttctctgactctaaggaccaaacaaaagctttttcctgtaagtcattgtctgcttcaacaatcttcctgttacaatgtgggagacaatttaaagaaccaaaccagaagtcttgtttggttcagccctttacctacaaatcacaactagcaaatataactgccaactattttccaaagcatatgttttagatgaacaccctctcccctggagagtcactgattcaattcaagtatgttataaaaatcaacttacagaaaattaaaaccttcttgagacaccacattctgtcaggtggtccaacattttggtccagactgaaatatctcagcaattattgagtggattgccataaaatgtggttcactcatttatctttctcagaggatgaatcctaatgactttggtgaccccagacctttcctctagtgccaccatgaggctcacgattgcagttttgagacaaatgtcttgcactattgagtggattcctatgcaatttggaacagacattcatgtctccctaaagatgggttttaccttgtgtcaccatctggtcaatctgtcagttagaatttgttcagtactttgatttgatccatttgaaaaaacaaattcagacagttagcaaatgttagcatgctaacacacaaaagtaagatgaacatgatcaacattatacctgctcaacatatggatgttagcattttcattgtatgttaccatgctgttgttggcatttagggcaaagtactgctgggcctaagaagctaagagttgtgagcatgactgtagccttgttattctgtatatttcatataatttaaaaccaagactgaaaatgcgatacaaatgtccacaatctcgtatcgacattgcgggaagacctgttaccccctactatcaagagaaaaaaatcagttcacttcttgttaccaataaaggatgttggtgattttgtgcctgaacttatcaaatgaaaatgtagtgtcaacattttctcatagtgcttttaccattttaccattacttaatggatgttcaaaattaatcagatgtgagttgtaaaatgccatcaccagcttagttagaatcttgatgaactagaactagaacagatgatgagaatgttcagttatcacatcatcactctagaactctgacagaatactgtacattctggttgaagcctggatctacagaacaaacctcatttaccttcatgatcttgaaccgagtaccgtctctgtctttggtgaacgaacgtacaactgttatagaacgacgacaactgatattcgacgaccactattttaacttcaacttctacttctacttcaacaactgtgactgctgtctttgctgcaactcaacaacaaatggacccacaaagacacctggcatttggacaaatgccattcactgctcccctttacaggcgagtcgctgctcccctttacagggcaagtcgctgcttccttttacggggcagcacagttcaaccctgctgtagtacagctgcagcagactgtacagggcctaagagatgccctctactccgccatctctgagataaaggctgtgaaggaagagaacaaggctcttaaggagcaagtgaggaagatggagaggaagcacagagaggagctgaaagaaaaagatgagctccttaacagagaagtcaacaaaaggagggctcgtactcaggcttatgtcaactgcctggacctgctcaatagacaagaaaaggcccttaagagtgcagagctgagaggtaaagctctagagtcaaacctgagatgggagctgactctcaaagaagagaaacatcaggaggagaagaaatacaaggaggaagtggaagaggagaccaagaggagtgaggatggttggaggagaatggagagccacctcagagaggagctcaatcataaagatgagctccttaaaaaagaaaccaaaaaaaggaaggctcgcactcaggcttatgttgactgcatgaacctgctcagtcaaaaagaaaaagatctgaaagagagtgaagagcagacacatgacgccttagagaagagtctaaaactggagctggctctgaaagaccagagagagcaggaggacaaatacaaagagaaggtggaggaggagactaagagggctgaggatgaactgaggaggatggagagccagttcacagaggagctgaaagaaaaagatgagctcctaaacagagaaatcaacaaaaggaggctcatactcaggcttatgttgactgcatgaacctgctcagtcaaaaagacaaggagctgaaggagagcaaggagcagacacgtaaagctttagagaagagtctgagcctggagctggctctgaaacaacagagagagcaggaggagaagaagagccaagagaagatgaagaacaaagacaacgaaaagctagagaagaacaaaggaggtgacgatggtcataggaggatagagagccagctgagacaggagctgaaagaaaaagatgagctcctggaaacaggaattaaaaaaaggaaggcctgcactaaggcgtacctggactgcctggtcctgctcagtcagaaagagaaggagcttcaggagagagaagagcagagacgaaacgccttagagaagagtctgagactggaactggctctaaaacaacagagagagcaggaggagaacaagagccaagaaaagatggagaaccaacacgatgaaaagacggaggaggagacagagaggagtgaagctaaagagatgaatgagaaaaaagagaaaccaaagaagaagagggggaagaaaaagaacaggggttagccacaacagaggatccctccctctgaaaccccacctctttccccccatcttaccttacccactcccctcaccctccttcccctttcctaccctctctttccctcttacccctttctcttttacccctttacccctctttcccctctctcccccacctctttccctctccctaaaacaaacccttcatgtcttgtttgtcatgtgtgttaaatatatgttttc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]