GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-29 21:12:35, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_045149000            2880 bp    mRNA    linear   ROD 16-NOV-2021
DEFINITION  PREDICTED: Jaculus jaculus argonaute RISC component 1 (Ago1),
            transcript variant X4, mRNA.
ACCESSION   XM_045149000
VERSION     XM_045149000.1
DBLINK      BioProject: PRJNA778790
KEYWORDS    RefSeq.
SOURCE      Jaculus jaculus (lesser Egyptian jerboa)
  ORGANISM  Jaculus jaculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Dipodoidea; Dipodidae; Dipodinae; Jaculus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_059106.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Jaculus jaculus Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2880
                     /organism="Jaculus jaculus"
                     /mol_type="mRNA"
                     /isolate="mJacJac1"
                     /db_xref="taxon:51337"
                     /chromosome="5"
                     /sex="male"
                     /tissue_type="liver, spleen"
                     /dev_stage="adult"
                     /country="USA: San Diego"
                     /lat_lon="32.72 N 117.17 W"
                     /collection_date="2021-06-15"
                     /collected_by="Kimberly Cooper"
     gene            1..2880
                     /gene="Ago1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 2 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:101613742"
     CDS             158..2038
                     /gene="Ago1"
                     /codon_start=1
                     /product="protein argonaute-1 isoform X3"
                     /protein_id="XP_045004935.1"
                     /db_xref="GeneID:101613742"
                     /translation="
MCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHISGQSNGRDPQALAKAVQVHQDTLRTMYFA"
     misc_feature    158..499
                     /gene="Ago1"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(293..295,338..340,380..382,392..394,446..448,
                     467..469,473..475)
                     /gene="Ago1"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    632..1909
                     /gene="Ago1"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1043..1045,1055..1057,1091..1102,1109..1111,
                     1133..1135,1142..1144,1154..1156,1166..1168)
                     /gene="Ago1"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1247..1249,1253..1255,1463..1465,1877..1879)
                     /gene="Ago1"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
gccattgtgagctggcgtatgttgcatgaagctttggtcagtggacagatccccgtgcccttggagtctgtgcaagccttggatgtggccatgagacacctggcatcaatgagtctcagccactgccttctacaaggcacagccagtgattgagttcatgtgtgaggtgctagacatcaggaacatagatgaacaacccaagcccctcacggactcccagcgtgttcgctttaccaaggagatcaagggtctgaaggtggaagtgacccactgtggacagatgaagaggaaataccgtgtgtgtaatgtcacccgccgccctgctagccatcagacgtttcccttgcagctggagagtggacagactgtggaatgcacagtggcacagtatttcaagcagaaatacaaccttcagctcaagtatccccatttgccctgcctccaagttggccaagaacaaaaacatacctatcttccccttgaggtctgtaacattgtggctgggcagcgctgcattaagaagctgactgacaaccagacttcgaccatgataaaggctacagctaggtcggccccagacagacaggaggagatcagtcgtctgatgaagaatgccagctacaacctcgacccctacattcaggaattcgggatcaaggtgaaggacgacatgacggaggtgacaggacgcgtgctgccggcgcccatcctgcagtacggcggccggaaccgggccattgctacacccaaccaaggtgtctgggacatgcgggggaagcagttctacaatgggattgagatcaaagtctgggccatcgcctgctttgcaccccaaaaacaatgtcgagaagaggtgctcaagaacttcacagaccagctgcggaagatttccaaggatgcaggaatgcccatccagggtcagccttgcttctgcaagtacgcgcagggggcagacagcgtggagcccatgttccggcatctgaagaatacctactcagggctgcagctcattatcgtcatcctgccagggaagacgcccgtgtatgctgaagtgaaacgtgttggagatacactcttgggaatggcaacgcagtgtgtgcaggtgaagaacgtggtcaagacctctcctcagactctgtccaacctctgcctcaagatcaatgtcaaacttggtggcattaacaacatcctagtcccacaccagcgctctgctgtctttcaacagccagtgatattcctgggagcagatgtcacacatcccccagcaggggatgggaaaaagccgtctatcacagcagtggtaggcagtatggatgcccaccccagccgatactgcgctactgtgcgggtacagcgaccacggcaggagatcatcgaagacttgtcctatatggtgcgtgaactgctcatccaattctacaagtccacccgcttcaaacctactcgcatcatcttttaccgagacggagtccccgaaggccagcttcctcagatcctccactatgagctgcttgccattcgtgacgcctgcatcaagctggaaaaggactatcaacctgggatcacttacattgtggtgcagaaacgccatcacacccgccttttctgtgctgacaagaacgagcgaattgggaagagtggtaacatcccagctgggaccactgtggacaccaacatcacccacccatttgagttcgacttctatctgtgcagtcacgcaggcatacagggcaccagccggccatcccattactacgttctgtgggatgataaccgtttcactgcggacgagctccagatcttgacataccagctgtgccacacttacgtacgatgcacacgttctgtctctatcccagcacctgcctactatgcccgcttggtggctttccgagcacgataccacctggttgacaaggaacatgacagtggagaggggagccacatatccgggcagagcaatgggcgggaccctcaggccctggccaaagctgtgcaggttcaccaggacactctgcgcaccatgtacttcgcttgaaggcagaacgctgtgacctcactggatagaagaaagctttccaagccccccaccctggagctgtgccgcccaaatccacaggaagcaaggaagagggaggcggggaagggagcagtggaggaggccttgtttctttctaccgacggggtgtaagggtggggaacagggccagcaagacagaccaccagccagaaatctcttacaccaacctcatgtcctccgaccctcacccatcttgtcatatctggccctggcccctctggactaagaggggcagcactggtgcccaccatacacacaggtgtctcatgtgactcacagtgctaaagactcatgcttgacagcttggtcaggtcagctctgcagccctgcggacaaaagctggtaggtttgggtttcatcctttaggtgggaaagtgaggggcttgagaaagtgggtgggaagagggaaggaaattttaggagccttaatcagaaaaggtctagatttgtttaagaaaaatgaaacccaacccagatcaatattttaggatactagatgttttcatgggttcagaatccagtttgtaggaagatttttaatgctaatggttttggttgctcctcccccagccgccaccctcccctgctacccttattcctccctctccacctttgctcccccactttcaccttatgcctcttccctgacagacatccagccccctagtaacacttgaggcactatggcacttagctctgaagtgacacgaccctgtcttccttccgcctgctggtgggtaaccagtgccttccctgtaatggttatgctgcagaaccgcaaccttttgtacctttctttg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]