2024-03-29 21:12:35, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_045149000 2880 bp mRNA linear ROD 16-NOV-2021 DEFINITION PREDICTED: Jaculus jaculus argonaute RISC component 1 (Ago1), transcript variant X4, mRNA. ACCESSION XM_045149000 VERSION XM_045149000.1 DBLINK BioProject: PRJNA778790 KEYWORDS RefSeq. SOURCE Jaculus jaculus (lesser Egyptian jerboa) ORGANISM Jaculus jaculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Dipodoidea; Dipodidae; Dipodinae; Jaculus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_059106.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Jaculus jaculus Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2880 /organism="Jaculus jaculus" /mol_type="mRNA" /isolate="mJacJac1" /db_xref="taxon:51337" /chromosome="5" /sex="male" /tissue_type="liver, spleen" /dev_stage="adult" /country="USA: San Diego" /lat_lon="32.72 N 117.17 W" /collection_date="2021-06-15" /collected_by="Kimberly Cooper" gene 1..2880 /gene="Ago1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:101613742" CDS 158..2038 /gene="Ago1" /codon_start=1 /product="protein argonaute-1 isoform X3" /protein_id="XP_045004935.1" /db_xref="GeneID:101613742" /translation="
MCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHISGQSNGRDPQALAKAVQVHQDTLRTMYFA"
misc_feature 158..499 /gene="Ago1" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(293..295,338..340,380..382,392..394,446..448, 467..469,473..475) /gene="Ago1" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 632..1909 /gene="Ago1" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1043..1045,1055..1057,1091..1102,1109..1111, 1133..1135,1142..1144,1154..1156,1166..1168) /gene="Ago1" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1247..1249,1253..1255,1463..1465,1877..1879) /gene="Ago1" /note="active site" /db_xref="CDD:240015" ORIGIN
gccattgtgagctggcgtatgttgcatgaagctttggtcagtggacagatccccgtgcccttggagtctgtgcaagccttggatgtggccatgagacacctggcatcaatgagtctcagccactgccttctacaaggcacagccagtgattgagttcatgtgtgaggtgctagacatcaggaacatagatgaacaacccaagcccctcacggactcccagcgtgttcgctttaccaaggagatcaagggtctgaaggtggaagtgacccactgtggacagatgaagaggaaataccgtgtgtgtaatgtcacccgccgccctgctagccatcagacgtttcccttgcagctggagagtggacagactgtggaatgcacagtggcacagtatttcaagcagaaatacaaccttcagctcaagtatccccatttgccctgcctccaagttggccaagaacaaaaacatacctatcttccccttgaggtctgtaacattgtggctgggcagcgctgcattaagaagctgactgacaaccagacttcgaccatgataaaggctacagctaggtcggccccagacagacaggaggagatcagtcgtctgatgaagaatgccagctacaacctcgacccctacattcaggaattcgggatcaaggtgaaggacgacatgacggaggtgacaggacgcgtgctgccggcgcccatcctgcagtacggcggccggaaccgggccattgctacacccaaccaaggtgtctgggacatgcgggggaagcagttctacaatgggattgagatcaaagtctgggccatcgcctgctttgcaccccaaaaacaatgtcgagaagaggtgctcaagaacttcacagaccagctgcggaagatttccaaggatgcaggaatgcccatccagggtcagccttgcttctgcaagtacgcgcagggggcagacagcgtggagcccatgttccggcatctgaagaatacctactcagggctgcagctcattatcgtcatcctgccagggaagacgcccgtgtatgctgaagtgaaacgtgttggagatacactcttgggaatggcaacgcagtgtgtgcaggtgaagaacgtggtcaagacctctcctcagactctgtccaacctctgcctcaagatcaatgtcaaacttggtggcattaacaacatcctagtcccacaccagcgctctgctgtctttcaacagccagtgatattcctgggagcagatgtcacacatcccccagcaggggatgggaaaaagccgtctatcacagcagtggtaggcagtatggatgcccaccccagccgatactgcgctactgtgcgggtacagcgaccacggcaggagatcatcgaagacttgtcctatatggtgcgtgaactgctcatccaattctacaagtccacccgcttcaaacctactcgcatcatcttttaccgagacggagtccccgaaggccagcttcctcagatcctccactatgagctgcttgccattcgtgacgcctgcatcaagctggaaaaggactatcaacctgggatcacttacattgtggtgcagaaacgccatcacacccgccttttctgtgctgacaagaacgagcgaattgggaagagtggtaacatcccagctgggaccactgtggacaccaacatcacccacccatttgagttcgacttctatctgtgcagtcacgcaggcatacagggcaccagccggccatcccattactacgttctgtgggatgataaccgtttcactgcggacgagctccagatcttgacataccagctgtgccacacttacgtacgatgcacacgttctgtctctatcccagcacctgcctactatgcccgcttggtggctttccgagcacgataccacctggttgacaaggaacatgacagtggagaggggagccacatatccgggcagagcaatgggcgggaccctcaggccctggccaaagctgtgcaggttcaccaggacactctgcgcaccatgtacttcgcttgaaggcagaacgctgtgacctcactggatagaagaaagctttccaagccccccaccctggagctgtgccgcccaaatccacaggaagcaaggaagagggaggcggggaagggagcagtggaggaggccttgtttctttctaccgacggggtgtaagggtggggaacagggccagcaagacagaccaccagccagaaatctcttacaccaacctcatgtcctccgaccctcacccatcttgtcatatctggccctggcccctctggactaagaggggcagcactggtgcccaccatacacacaggtgtctcatgtgactcacagtgctaaagactcatgcttgacagcttggtcaggtcagctctgcagccctgcggacaaaagctggtaggtttgggtttcatcctttaggtgggaaagtgaggggcttgagaaagtgggtgggaagagggaaggaaattttaggagccttaatcagaaaaggtctagatttgtttaagaaaaatgaaacccaacccagatcaatattttaggatactagatgttttcatgggttcagaatccagtttgtaggaagatttttaatgctaatggttttggttgctcctcccccagccgccaccctcccctgctacccttattcctccctctccacctttgctcccccactttcaccttatgcctcttccctgacagacatccagccccctagtaacacttgaggcactatggcacttagctctgaagtgacacgaccctgtcttccttccgcctgctggtgggtaaccagtgccttccctgtaatggttatgctgcagaaccgcaaccttttgtacctttctttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]