GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-23 22:58:53, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_044333690            5180 bp    mRNA    linear   VRT 15-OCT-2021
DEFINITION  PREDICTED: Thunnus albacares centriolin (cntrl), mRNA.
ACCESSION   XM_044333690
VERSION     XM_044333690.1
DBLINK      BioProject: PRJNA769113
KEYWORDS    RefSeq.
SOURCE      Thunnus albacares (yellowfin tuna)
  ORGANISM  Thunnus albacares
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Pelagiaria; Scombriformes; Scombridae; Thunnus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_058107.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Thunnus albacares Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5180
                     /organism="Thunnus albacares"
                     /mol_type="mRNA"
                     /db_xref="taxon:8236"
                     /chromosome="2"
     gene            1..5180
                     /gene="cntrl"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 11 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:122968450"
     CDS             82..4485
                     /gene="cntrl"
                     /codon_start=1
                     /product="centriolin"
                     /protein_id="XP_044189625.1"
                     /db_xref="GeneID:122968450"
                     /translation="
MSRKQSELEGRLDDMLTRIAMETQEIKELEQQLTDGQILANEALQRDLEGIISGLQEYLRSLREQARRAQQQVHSLQDENQSLQLHLQDAQRHCRQLQDTARTHTQNMSLQQEELSVLQMEAQALRDRQVESSRQQVELEAELQQLREELSRQLTLGKLERDALQAAVDNEKQSREIRESQLQSTIDTLQDDKSSLQQIVHKLQAQLDQTEDQLHQSRTQFKETRSQLEQLSAALLDEDRTRAEDKSSPEDTLSSSVEQLYRTVQQTRTSKEQVHNQNQQQIERLQAQLAQDQEHIAQLEAQLAWDQDLVTRGVEQDQELQRLRDKLQRYQSMNRHIQHKLEAELQQSRLQLQDVQQERDALLLQLRSQSDGHQKSLARLNRKLRQLSRFMCDSDQLTSEQLRSTSEQLRALNRTVELLHTQKTVDEHDDSSHQTEHTHTLEDEHTHTLQDEHTHTLQDEHTHTLQDEHTHTLQDEHTHTLQDEHTHAVEELRAELAEAQQHASRLRQQLDQVRTRTRTRTRTRTRTRTRTRSRSRTRSRTRSRTRSRIRDGGQWCFIPPGHSAPSLGSQGTQDSGLGLQYLSSPERAQQQHRPPTGGGYWVYIPPAHTDSDTGAEWRDSGGGSDTDRSSRGGTPPPPPAPAAGVSEGPSDAQTPLAGPAWLLCGSPAAVVYSPPAGGAALHCNIPEHTHREGMCVCECERLREAERLEEEKKKLRLETKQLRHTLRRHRSVKLVCDEVECVEKTLLKRRAELRQADRLLLEAQSCIHTTRDQARSAQREADTLQHRAQDSATCLLEATQHVRELQEELEELRRRRQLEEQTLREMEEVLRSRDQKFQQLSTKTHSAADRLALVLSDCQEAQRRLDSVNSQVEQQEQRLLQRKEEHHAALSRLKEVRQEEQRLQDAVKELWEQQEVLLSERRSSVSAVNEEEQKLLTLQSELNTHRAELKRVLQELLAEQQALEEVKTKRTQTLQRLHKKKDELHRTKDELHRTKDELHRTKDELDRTKDELHRTKDELHRTKDELDRTKDELHRTKDELHRTKDELDGTKDELDGTKDELHRTKDELHRTKDELHRTKDELDGTKDELDRTKDELLMKQEELDRKRDLLDGIQDEVEKKKDELVNKQHKSDQKRHKLDKMQDEVERKREELAALQQEVDSHRKESESRLKNTKQQRTELQELQEELSRRREESSSLQEQCKHLEARRRHADRCLSATEAELAKQREEHSRAQLLKQEVIRDTAAAQEQLNENSELLSLLSEQLEQKKKQLQTVEQELNESSQQQRAEHIQHKQVSAGLDDVKAAACQLEDRGRRLNHQQLQLNQLSEQLWQREKQLLCEEERLIHMRAGLQREGEELIQTEEELQKKEKEEDSREVLKEEDESFYLSTAGLRSAFNTEEERWKVELQREKLRQQEDRLKARLRCSLWNQQENLEVRRLETEESLLGLKHRLDQLDSLLTHTETHTP"
     misc_feature    223..>1194
                     /gene="cntrl"
                     /note="Chromosome segregation ATPase Smc [Cell cycle
                     control, cell division, chromosome partitioning]; Region:
                     Smc; COG1196"
                     /db_xref="CDD:440809"
     misc_feature    <913..>1605
                     /gene="cntrl"
                     /note="Uncharacterized conserved protein, contains a
                     C-terminal ATPase domain [Function unknown]; Region:
                     COG4913"
                     /db_xref="CDD:443941"
     misc_feature    <2551..4299
                     /gene="cntrl"
                     /note="MAEBL; Provisional; Region: PTZ00121"
                     /db_xref="CDD:173412"
     polyA_site      5180
                     /gene="cntrl"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
ctactgacactggacatcacagacccacaacatgcccgtgtgacgtcccggttggccagtgtgagacagctgttggacaggatgagcaggaagcagagcgagctggagggtcgcctcgacgacatgctgacacgcatcgccatggagacacaggagatcaaagagctggagcaacagctgaccgacggtcagattttggctaatgaagctcttcagagggatttggagggaatcatttctggacttcaggagtatctgagatccctcagagagcaggctcgtcgagctcagcagcaggttcacagtctgcaggatgaaaaccagagtctgcagctccacctgcaggacgctcagagacactgcagacagctgcaggacacggccaggacacacacacagaacatgtccctccagcaggaggagctgtctgtgttgcagatggaggcccaggctctgagagacagacaggtggagagcagcagacagcaggtggagctggaggcggagctccagcagctgagggaggagctaagccggcagctcacactgggaaagttggagcgtgatgcgctgcaggcagctgtagacaacgagaaacagagcagagagatcagagagtctcagctacagtcaaccattgacacactgcaggatgacaaatcatctctccagcagattgttcacaaacttcaggctcaactggaccaaactgaagaccagttacaccagagcagaacccagtttaaagagaccaggagccagctggagcagctgtcagctgccttgttggacgaggacagaaccagagcagaggacaagtccagtcctgaggacacgttgtccagcagtgtggaacagctctacaggaccgtccagcagaccaggactagcaaggagcaggtccacaaccaaaaccagcagcagatagaaagactgcaggcccagctggcccaggaccaggagcacatagcccagctggaagcccagctggcctgggaccaggacctggtgacccgcggcgtggagcaggatcaggagctgcagaggctccgagacaaactgcagagatatcagagcatgaacagacacatccaacacaaactggaggcggagctacagcagagccgtctgcagcttcaggacgtccagcaagagagagacgctctgctcctgcagctgcgttcacagagcgacggtcaccagaagagcctcgcacgtctgaacaggaaactacggcaactcagcaggttcatgtgcgactctgatcagctgacaagcgaacagctgagatcaacctccgaacagctgagagctctgaaccgcactgtggagctgctgcacacacagaaaactgtggatgagcacgacgacagctctcaccaaactgaacacacacacactctggaggatgaacacacacacactctgcaggacgaacacacacacactctgcaggatgaacacacacacactctgcaggatgaacacacacacactctgcaggacgaacacacacacactctgcaggatgaacacacacacgcagtggaggagctgagagcagagctggctgaagctcagcaacatgcaagcagactgagacagcagctggaccaggtcaggaccaggaccaggaccaggaccaggaccaggaccaggaccaggaccaggaccaggagcaggagcaggaccaggagcaggaccaggagcaggaccaggagcaggatcagagatggaggccagtggtgcttcatccctcctggacacagtgctcccagtctgggctctcaggggactcaggactctggtttggggctgcagtacctcagttctcctgagagggcacaacagcagcacagacctcctacaggaggcgggtactgggtctacatccccccggcacacaccgactctgacacaggagcagagtggagggacagcggaggaggcagtgatactgaccgcagctccagaggagggactcctcctcctcctcctgccccagctgcaggtgtctctgaggggccctctgacgctcagactcccctggctggacccgcctggctgctctgtggttcacctgcagctgttgtctacagtcctcctgcggggggcgccgcactgcactgtaacatccctgaacacacacacagggaaggcatgtgtgtgtgtgaatgtgagaggctcagagaggcagagcgactggaggaagagaagaagaaactacgactggaaaccaaacaactacgacacacactgagacgacacaggagtgtgaagctggtgtgtgatgaggtggagtgtgtagagaaaactctgctgaagagacgagccgaactccgtcaggctgacagactgctgctggaggctcagagctgcatacacaccaccagagaccaggccagatcagcccagcgggaggcggacaccttgcagcacagagctcaggacagcgccacctgtctgctggaagccacgcagcacgtcagagagctgcaggaggagctggaggagctgaggaggaggaggcagctggaggagcagactctgagggagatggaggaggtgctgaggagcagagatcagaagttccaacaactcagcacgaaaacacactcagctgcagacagactggctctcgtgctgtcggactgtcaggaggctcagaggcgtctggactcggtgaacagtcaggtggagcagcaggagcagaggctgcttcagaggaaggaggagcatcacgccgctctgagcagactgaaggaggtcagacaggaggagcagcgactgcaggacgccgtcaaggagctgtgggagcagcaggaggtgctgttgagtgagaggaggtcttcagtctctgctgtgaacgaggaggagcagaaactcctcacgctgcagtctgagctcaacacccacagagcagagctgaaacgggtccttcaggagctgcttgcagagcagcaggctttggaggaagtgaaaaccaaacgcacccagactctccagcggctccacaagaagaaagacgagctgcacagaaccaaggacgagctgcacagaaccaaggacgagctgcacagaaccaaggacgagctggacagaaccaaggacgagctgcacagaaccaaggacgagctgcacagaaccaaggacgagctggacagaaccaaggacgagctgcacagaaccaaggacgagctgcacagaaccaaggacgagctggacggaaccaaggacgagctggacggaaccaaggacgagctgcacagaaccaaggacgagctgcacagaaccaaggacgagctgcacagaaccaaggacgagctggatggaaccaaggacgagctggacagaaccaaggacgagctgctcatgaagcaagaagagttggacaggaagcgggatttgttggacgggatacaggacgaggtggagaagaagaaggacgagctggtgaacaagcagcacaagtcggaccagaagagacacaaactggacaaaatgcaggatgaagtggagcggaagagggaggagctggctgcgctgcaacaggaagttgattcccacagaaaagagtcagagtcacgtctcaaaaatactaaacagcagcgaacagaactgcaggagctgcaggaggagctgagcaggaggagggaggagagcagcagcctgcaggagcagtgtaaacacctggaggccagacggaggcacgccgacaggtgtctgtcagcgacggaggcggagcttgctaaacagagggaggagcatagccgcgcccagctccttaaacaggaagtgatccgagatacagcagccgctcaggagcagcttaatgagaactcggagctgctgtcgctgctcagtgaacagctggagcagaagaagaagcagctgcagactgttgaacaggagctgaacgagtccagtcagcagcagagagcagaacacatccaacacaaacaggtgtctgctgggttggatgatgttaaagctgcagcgtgtcagctggaggacagggggcgccgtctgaaccaccagcagctgcagctcaaccagctcagtgagcagctgtggcagagagagaaacagctgctttgtgaggaggagaggctcatccacatgagggcggggctacagcgggaaggggaggagctaattcagacagaggaggagctccagaagaaagagaaggaggaggacagcagggaggtgttaaaggaggaggacgagtctttctatctgtctacagctggtctgagatcagctttcaacactgaggaggagaggtggaaggttgagttgcaaagagaaaaactgagacaacaagaagaccgactaaaggctcgtcttcgctgcagtttgtggaaccagcaggagaatctggaggtgagacgactggagacggaggagagtttactgggactgaaacacagactggaccagctggactcactgctcacacacactgaaacacacactccctaacacacacacacacacacacacagcaaacattcagtaacccgtctgtctgactttaacagagaaacatatgcagctcaaactgacgtaactttatgaatctagagtcacgcagcagccgatgaaactcacacaatgttttcaaaacctcacacatccttcttctcctgttcacacacgactaaacatgaagagatactgtcgtccttctcaagttcagctgcagataatacgagtcctcatcagtctgagttacactaatcaagtctgtttagttccaaaaaaaataaatctcttcacagcggattatgcaacaggaggaaagaacttgtgcacagtctcacttattgtttactagttcagtctgtccgaccttcatcagctgcttcattaaaagatacaaatatgaacccaaactgcaataaaccatgaagatgatcctttacagctttgtggattaatctgctggttatgttcttgatgactttattaatcatttgtactttgacatgttggagccttcatagtgtttcagtgatgatgtttaatcagctggaaccagtcgatgcagctcttcagtgtggaaacactgagctgaacatctgaatgaaatcatgtgtttcaaggtttgtttgtaaaaaaacatgtaaaaactgatatttatctttgaattaaacactctgaacatgttaaagctc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]