LOCUS       XM_044316009            1071 bp    mRNA    linear   INV 14-OCT-2021
DEFINITION  PREDICTED: Acropora millepora protein argonaute-4-like
            (LOC122956347), mRNA.
ACCESSION   XM_044316009
VERSION     XM_044316009.1
DBLINK      BioProject: PRJNA767661
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Acropora millepora
  ORGANISM  Acropora millepora
            Eukaryota; Metazoa; Cnidaria; Anthozoa; Hexacorallia; Scleractinia;
            Astrocoeniina; Acroporidae; Acropora.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_025323232.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Acropora millepora Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 15% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1071
                     /organism="Acropora millepora"
                     /mol_type="mRNA"
                     /isolate="JS-1"
                     /isolation_source="Whole tissue"
                     /db_xref="taxon:45264"
                     /chromosome="Unknown"
                     /tissue_type="Adult tissue"
                     /country="Indonesia"
                     /collection_date="2017"
     gene            1..1071
                     /gene="LOC122956347"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 84% coverage of the annotated
                     genomic feature by RNAseq alignments"
                     /db_xref="GeneID:122956347"
     CDS             1..1071
                     /gene="LOC122956347"
                     /codon_start=1
                     /product="protein argonaute-4-like"
                     /protein_id="XP_044171944.1"
                     /db_xref="GeneID:122956347"
                     /translation="

MLYFLPEIINTEENKTVVTTDDVELDKETCRLQNAQLPCSPEFIFLAEVDFHVTLPMENSKDKTFKVTVKWVAQVSLFALEQALEGKHNQIPFEAIQALGVVLRHLPSMKYTSVGRSFFSPPEGYYHPLESGREVWFGFHQSVRPSQWKMMLNIDVSATAFYKCQPVVEFLCEVLRKSPQDLQRGKLLTDAERMKLSREIKGLKVEITHCGTMKRKYRVINVTKQPAQSLKFPLKQMDTGQQREITVARYFQEKHSKKLQYPHLPCLQVGQEQKHTYLPMEVCNLVAGQRCRKRLTDQQTAKTIRATAKRAPDRENEILNLVIMMDNDGCPLWEVSLERSLFLKQSVFQLIQNLVF"

     misc_feature    187..>942
                     /gene="LOC122956347"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    493..858
                     /gene="LOC122956347"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(649..651,694..696,739..741,751..753,805..807,
                     826..828,832..834)
                     /gene="LOC122956347"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
ORIGIN      

atgctatattttctgccagaaatcattaacacagaggaaaacaaaacagtcgtaaccacggatgatgtggaactcgacaaggagacgtgtcgcttgcagaatgctcagttaccctgttcgccagaatttatcttcttggctgaggtggattttcatgtcactcttccaatggagaacagcaaagataaaacattcaaagtgacggtaaagtgggtcgcacaagtcagcctctttgcactggagcaggcgttggagggcaaacataatcagattccatttgaagcaatccaagcccttggtgttgtgttgaggcatttaccttccatgaaatacacctcagtaggaagatctttcttttctccccctgaaggctactatcatcccctggagagcggccgggaagtatggtttggttttcatcaaagtgtgagaccctcgcagtggaaaatgatgctgaacatcgatgtgtccgcaacagcattttacaaatgtcagcccgtcgtggaattcttatgcgaagtccttcggaaatcgccgcaagatcttcaacggggcaaactcttaacagatgctgagagaatgaagctaagtagagaaatcaaaggactcaaagtggaaataactcactgtggcacaatgaagagaaagtacagggttattaatgtaacaaaacaaccggcgcagtctttgaaatttcctcttaagcagatggacacgggacagcaacgagagatcacggtggcgagatacttccaggaaaaacactcaaagaaacttcagtacccgcatcttccctgccttcaagttggacaagaacaaaaacacacttacctcccaatggaagtttgtaaccttgttgctggtcagaggtgtagaaagagactaacagatcagcaaacagccaagacgattcgagccacggcgaagagagctccggacagagaaaacgagattctgaacttggtcataatgatggataatgatggatgtcccctttgggaagtttcactcgaaagaagtttgttcttaaagcaatctgtgttccaactgatccaaaatttggtcttttag

//