GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-19 05:32:55, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_042482082            3105 bp    mRNA    linear   VRT 19-JUL-2021
DEFINITION  PREDICTED: Plectropomus leopardus GTP binding protein 3,
            mitochondrial (gtpbp3), transcript variant X2, mRNA.
ACCESSION   XM_042482082
VERSION     XM_042482082.1
DBLINK      BioProject: PRJNA744194
KEYWORDS    RefSeq.
SOURCE      Plectropomus leopardus (leopard coralgrouper)
  ORGANISM  Plectropomus leopardus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Perciformes; Serranoidei; Serranidae;
            Epinephelinae; Epinephelini; Plectropomus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_056465.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Plectropomus leopardus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3105
                     /organism="Plectropomus leopardus"
                     /mol_type="mRNA"
                     /isolate="mb"
                     /db_xref="taxon:160734"
                     /chromosome="3"
                     /tissue_type="muscle"
     gene            1..3105
                     /gene="gtpbp3"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 9 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:121938921"
     CDS             250..1794
                     /gene="gtpbp3"
                     /codon_start=1
                     /product="tRNA modification GTPase GTPBP3, mitochondrial
                     isoform X2"
                     /protein_id="XP_042338016.1"
                     /db_xref="GeneID:121938921"
                     /translation="
MMLSSIYRGIWRAAVHTLTTRGTPYRFLSTSDRLPLADAESIFALSSGHGRCGVAVVRASGPASATALKCMTGLTHSLPPPRTAMLRNITDPQTKEVLDRGLVLWFPAPHSFTGEDSVEFHIHGGPAVITGVLQALGSVPGMRPADAGEFTRRAFQAGKLGLTEVEGLGDLIHAETEAQRRQALRQMSGELGRLYQDWSHRLKRCLAHVEAFIDFSEDELIEDGVLNQVDRSVCDLQTQIECHLKDERRGERLRSGVLVVIAGATNAGKSSLLNTLCQRPAAIVSPIAGTTRDVVEMALDIGGFPVLLSDTAGLRESPDLVEREGVRRARERVEQADLTLVVVDSSHLPSDAQKAAAFLQEYLGSVLPTVEQPETVFPADRFLLVLNKTDLLPQEQKLKLDRQLRQVSGLPPVCFISCHTNEGLQDFLAVLHSSVKTLCGDPLSGAPSLTQARHRAHLQQCVSALAQYQRYRDIDLALAAEGVRLALTSLGRITGRVGAEEILDIIFKDFCIGK"
     misc_feature    373..1791
                     /gene="gtpbp3"
                     /note="tRNA uridine-5-carboxymethylaminomethyl(34)
                     synthesis GTPase MnmE; Region: trmE; PRK05291"
                     /db_xref="CDD:235392"
     misc_feature    1036..1059
                     /gene="gtpbp3"
                     /note="G1 box; other site"
                     /db_xref="CDD:206727"
     misc_feature    order(1045..1047,1051..1062,1408..1413,1417..1419,
                     1498..1506)
                     /gene="gtpbp3"
                     /note="GTP/Mg2+ binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:206727"
     misc_feature    1081..1131
                     /gene="gtpbp3"
                     /note="Switch I region; other site"
                     /db_xref="CDD:206727"
     misc_feature    1120..1122
                     /gene="gtpbp3"
                     /note="G2 box; other site"
                     /db_xref="CDD:206727"
     misc_feature    order(1174..1206,1210..1254)
                     /gene="gtpbp3"
                     /note="Switch II region; other site"
                     /db_xref="CDD:206727"
     misc_feature    1177..1188
                     /gene="gtpbp3"
                     /note="G3 box; other site"
                     /db_xref="CDD:206727"
     misc_feature    1408..1419
                     /gene="gtpbp3"
                     /note="G4 box; other site"
                     /db_xref="CDD:206727"
     misc_feature    1498..1506
                     /gene="gtpbp3"
                     /note="G5 box; other site"
                     /db_xref="CDD:206727"
ORIGIN      
cttgaaagtcgccggtgctggagcttgttacttaatgaagctttcacagaataatatagtaagcctaaacttgatgaattatcagcattatcagctaacgttacatttcaggttacttccggacattagcttaaagtgaaaaaggtaaaaataatgattttgtcaaggacacatcctgtttcagtgtcagtctgtgaaatcagacacaccagaaacagcacatgaaacgtttggtgttagtatattttaatgatgctgtcatccatttatcgtgggatatggagagctgctgtccacacgcttacgacaagaggaacaccttacagattcctctccacttctgatagactcccactggctgatgctgagtccatctttgcattatcatcaggtcatggcaggtgtggggtcgctgtggtacgagccagtggtccagcttcagctacagctctgaagtgtatgactggtctcacacacagtctgccgcctccacgcaccgccatgttacgcaacatcacagacccccaaaccaaagaagtgctggaccgtggacttgttctgtggttcccagctcctcacagtttcaccggagaggacagtgtggagttccatatccacggaggtcctgctgtcattactggtgtcttacaggctctaggaagcgtgcctggcatgaggcctgctgatgctggagagttcacgcggagggcctttcaagcagggaagctgggtttaacagaggtggaggggcttggggatctgatccatgctgagacagaggcccagaggagacaggctctcaggcagatgtcaggagagctgggacggctttatcaggactggagccacagactgaaacggtgtctggctcatgttgaggccttcatagacttcagtgaggatgagctcattgaggatggggtcttaaaccaagtggacaggtcggtgtgtgatctgcaaacacaaattgagtgccacctaaaggatgagaggcggggtgagcggctacgcagcggagtcctggtggttatcgcaggggccaccaatgcagggaaaagtagcctcctcaacacactctgccaaagacctgcagccattgtgtcccccattgctggcaccaccagggacgtagtagagatggcacttgacatcggtgggtttcctgtcctcttgagtgacacagccggcctcagagagagccccgacctggtggagagagagggggtacgccgagctcgagaaagagtggaacaggcagatctgaccctggtggttgtggactcttctcatctcccctctgatgcacagaaagctgcagccttccttcaggagtacctcgggagtgtcctgcccactgtggagcagccagagacagtgtttcctgcagacagatttctcctagtgctgaataaaactgacctgttgcctcaggagcagaagctgaagctggacaggcagctgagacaggtctcaggactccctcctgtttgtttcatctcttgccacactaatgaaggactgcaggacttcctagcagtccttcacagcagtgtcaagactctgtgtggagaccctttgtctggtgcccctagcctgacccaggctcgccacagggcccacctgcagcagtgtgtttcggccctggctcagtaccagcggtaccgcgacatcgacctcgctctggcagccgagggtgttcgtttggctctcaccagcttgggccggatcactggacgtgttggggcagaggagatcctggatatcatcttcaaagacttttgcattggaaagtagtcagatgagtaaaaacatgaaatacatgtaatatcagtctgctcagagcggaagtctgcattcttgtttggtcccagagtatcagttaagaaaacaagaaaaaaagggcaacgcctcggcataatgccaggcttcgaggcgcagcaagagtaaaaagaagaaaattcatgttcttggctgcaggatcactctgctcccaagacacattaatctttgttttccatagatgctctttgagagcctgaaatatttttaacgtgatgacaggtgcctcaaaagccccgtttgctagacaagtgtttggcaagtcttgagtcgtaatttaaaaatagcttctgaaagcctttgataggtgaacattgggctcttgggtcccaacataacagccaagatcatttaaaatacagccagctgcagacctctgcaaggtcatggacccatagtttggatgtttacttgtactgcaggacaatgaataattttcctttttgggagcagatatttcagctgcacccctcggtgtttgtctgaatgctagaatgcttcacgaatcagttaagatgcagttacagttaaatctatgtctgttgagactcatgtgatgttttgtttttctaagtgtttttgcagaacattaagatgtcacagtaaagcttacctttgaacttttggatataaaatgtcttcacattatattcctttagacatttgtgtgaaattgagttatggccaaaaacatttttagtcaggtcagagtgaccttgatcttgtgcatcaaaatctaatcagtcttttgttgtgtccaagtgggcaattgtgccaaatttgaagaaattccctcacagttttcttgagatatcacattcatgcatatgagatggaggtcacagtgaccttgacctttgacctttaacacctaaaaactaatcagttcattgtcaagtccaacattgagttgaactcgacaatgactagctttgattccagccctgagacattttttacatgtcaaaccccgctctttctctgtccccaatttctgcaccatactctgtcaaattaaggaaaaagtgccacaaacaattattttttaaaaccaaaaaaagtgttatttgcctatttacacacccatccgacagggaacaatattaccattatgtttctgtttattgtgttcttacatgttattacatatttgaaggtgcatcaggttgttactgtaattaaaaagaatgtaaggctttaaaaaagcagggtgtttacaagaccttaaaaagttttaaaatgtattcgattcagacttagacttag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]