GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2022-01-26 16:58:17, GGRNA.v2 : RefSeq release 209 (Nov, 2021)

LOCUS       XM_041496673            1963 bp    mRNA    linear   INV 09-MAY-2021
DEFINITION  PREDICTED: Gigantopelta aegis uncharacterized LOC121371050
            (LOC121371050), mRNA.
ACCESSION   XM_041496673
VERSION     XM_041496673.1
DBLINK      BioProject: PRJNA727593
KEYWORDS    RefSeq.
SOURCE      Gigantopelta aegis
  ORGANISM  Gigantopelta aegis
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Neomphalina; Neomphaloidea; Peltospiridae; Gigantopelta.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_054699.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Gigantopelta aegis Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1963
                     /organism="Gigantopelta aegis"
                     /mol_type="mRNA"
                     /isolate="Gae_Host"
                     /isolation_source="hydrothermal vent"
                     /db_xref="taxon:1735272"
                     /chromosome="1"
                     /tissue_type="foot"
                     /country="Indian Ocean"
                     /collection_date="2019-04"
     gene            1..1963
                     /gene="LOC121371050"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 4 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:121371050"
     CDS             46..1320
                     /gene="LOC121371050"
                     /codon_start=1
                     /product="uncharacterized protein LOC121371050"
                     /protein_id="XP_041352607.1"
                     /db_xref="GeneID:121371050"
                     /translation="
MPGKKKGKGKGKGKGKGKGKGKGKGKKSVQSRDLVVMKNLLKQYDRNCVFTGSQPSASIRHIIKECIEQEKCLSKFILESANPEPEHPVLVEPLLVAFRQIRYDQMKDLHIWNYPMSYENCASLALLLEKPFCNIRLLELVDCLIEAYSINRLAKCFSSNQNLTTLNLDYNEFGDTGVMYLCQGLQDNSSVLSLSLCFCGLGIPSGRLLGKLISTTAVRELYLDGNDLECEGTLELIKLPVDQAEMEAFHRAQIVRLAEEEKLRKLEEEKTNRFKAGTSGESSTEDGGKSSNTSKKKKKGKKKKSKGPPAPPPIGPWIHKLHLADNGIDGMGNKGTFAPVIVMRLFKKLLAHSMCLEELDLEDNLIGDLGGQELKNALTLRKEAKLPSVKIRTTHRMSPNIFNSIVKLGSGLSKKKKKGKKKKK"
     misc_feature    <370..>753
                     /gene="LOC121371050"
                     /note="Leucine-rich repeats (LRRs), ribonuclease inhibitor
                     (RI)-like subfamily. LRRs are 20-29 residue sequence
                     motifs present in many proteins that participate in
                     protein-protein interactions and have different functions
                     and cellular locations. LRRs correspond...; Region:
                     LRR_RI; cl39015"
                     /db_xref="CDD:423007"
     misc_feature    1102..1182
                     /gene="LOC121371050"
                     /note="Leucine rich repeat, ribonuclease inhibitor type;
                     Region: LRR_RI; smart00368"
                     /db_xref="CDD:197686"
ORIGIN      
tacatacagtatagttaacaacagtgacaacaaaccaactgaaagatgccgggtaagaaaaaaggaaagggcaaaggaaaaggcaagggaaaaggaaaaggcaagggcaaaggaaaagggaagaaatctgttcaatccagggatctagttgttatgaagaacttgttgaagcagtatgatcgcaactgtgtgtttactggatcacagccgagtgctagtataagacacattattaaagaatgcattgaacaggaaaaatgtctaagcaaatttatattagagtcagcaaatccggaacctgaacaccctgtattagtcgaacctctgctagtcgcattccgccagatccggtacgaccaaatgaaggatctccatatatggaattatccaatgtcatatgaaaattgtgcatctcttgcattgttattagagaaaccattttgtaatattcgtctgcttgaactggttgactgtctgattgaggcctactccattaacagactcgccaaatgtttttcatctaatcagaatttgacaactctaaatttggattataatgagtttggcgatacaggagtaatgtatctgtgtcagggactgcaggataacagcagtgtcttgtctctcagtctctgtttctgcggtctcggaattccgagcggaagactccttggaaagttgatttccaccacagctgtcagagaactctatttggatgggaatgacctggaatgtgaaggaacgctggagctcatcaaactccccgttgaccaggcggaaatggaggcgtttcacagagcacagatcgtgcgacttgcagaggaagagaaactccggaaactggaagaagaaaaaactaatcggtttaaagctggtacaagcggtgaaagctccacagaggatggagggaaatcatctaacacaagcaagaaaaagaagaaaggtaaaaagaaaaagtcaaagggccccccagcaccgcctcctataggaccatggatacacaagttacatttagccgacaatggcatcgatgggatgggaaataaaggcaccttcgccccagtgatcgtcatgagattgttcaagaaattgctggcacactccatgtgtttggaggaactcgaccttgaagacaacctgataggtgaccttggaggccaggagttaaagaatgctctcactcttagaaaggaagcgaaattgcccagcgtgaagatcagaacgactcaccgaatgagtcccaacatcttcaactccatcgtcaaactcgggtccgggctcagcaagaaaaagaaaaaaggcaagaagaaaaagaagtagaagacttagtaagatttttatcaaaatggattctctaaaccgggactacaagtctagcattctacacaccagtgtttggcgtaatggccatcacatagcaaggcaacacatggtgttgtcattgtcagtcaatgttttaagaattttgtttcaacagactctttagtgaaaatctgtgcagacataactatacattgaaatatttttgaataatgtaaagtaatgtgttttcttcttgttagtgatcattgtttatatgcccatctatagtgggtagtattatggtgtggtgttgtgcgtccattcatccgtatgtccgtctgttaattttttcttgtccggatcatatcttgcatacaggaccatcaaacctcacatgtaggaacaacttgggatggtggtgtgttgcgttctactactaggtcactgtgacctacttttcatggtctactgcacataacaataaatccttgttttgatcatatcttgcatacagatgaatacaggaccatcatatgtcacatgtaagaacaacttgggatggcggtgtgttgcgttctattactaggtcattgtgacctacttttcacagtctactgcacataacaataaatccttgtccagatcatatcttgcatacaga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]