ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-12 21:46:14, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_041279492 543 bp mRNA linear PLN 15-SEP-2021
DEFINITION Brettanomyces bruxellensis uncharacterized protein (BRETT_000934),
partial mRNA.
ACCESSION XM_041279492
VERSION XM_041279492.1
DBLINK BioProject: PRJNA691332
BioSample: SAMN12257691
KEYWORDS RefSeq.
SOURCE Brettanomyces bruxellensis
ORGANISM Brettanomyces bruxellensis
Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
Pichiomycetes; Pichiales; Pichiaceae; Brettanomyces.
REFERENCE 1 (bases 1 to 543)
AUTHORS Roach,M.J. and Borneman,A.R.
TITLE New genome assemblies reveal patterns of domestication and
adaptation across Brettanomyces (Dekkera) species
JOURNAL BMC Genomics 21 (1), 194 (2020)
PUBMED 32122298
REMARK Publication Status: Online-Only
REFERENCE 2 (bases 1 to 543)
CONSRTM NCBI Genome Project
TITLE Direct Submission
JOURNAL Submitted (15-SEP-2021) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
REFERENCE 3 (bases 1 to 543)
AUTHORS Palmer,J.M.
TITLE Direct Submission
JOURNAL Submitted (19-OCT-2020) CFMR, USDA Forest Service, 1 Gifford
Pinchot Drive, Madison, WI 53726, USA
REFERENCE 4 (bases 1 to 543)
AUTHORS Roach,M.J. and Borneman,A.R.
TITLE Direct Submission
JOURNAL Submitted (07-AUG-2019) Research, Australian Wine Research
Institute, Corner of Hartley Grove and Paratoo Road, Urrbrae, SA
5064, Australia
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. This record is derived from an annotated genomic
sequence (NC_054689).
COMPLETENESS: incomplete on both ends.
FEATURES Location/Qualifiers
source 1..543
/organism="Brettanomyces bruxellensis"
/mol_type="mRNA"
/strain="UCD 2041"
/isolation_source="fruit wine"
/culture_collection="AWRI:2804"
/db_xref="taxon:5007"
/chromosome="8"
/geo_loc_name="Thailand"
/collection_date="06-Aug-2013"
gene <1..>543
/locus_tag="BRETT_000934"
/db_xref="GeneID:64572859"
CDS 1..543
/locus_tag="BRETT_000934"
/codon_start=1
/product="uncharacterized protein"
/protein_id="XP_041137706.1"
/db_xref="GeneID:64572859"
/translation="
MVAYQFSSVCENCELNVNMSDSDKTDKKFPRSSLSRTTTTTSITTPVHPMELVVQSLLESPLELLNLSIHSLYESQMILTTILDRMQRKLDKCLRGIGKSRQEPITTDTDTQNLQYPNEHRNRANSDDDLTTQPGPDKSLTIEEYAARIHTIKLRIVKIHDTLDHVEKKIAQINTNLSSA"
ORIGIN
atggttgcataccaatttagttccgtttgtgagaattgtgaactaaatgtgaacatgagtgactcagataaaacagacaagaaatttccacgctcttctctttccagaacaactacaacgactagcataactacccctgttcacccaatggaattggttgtacaatctcttcttgaatcacctcttgagcttctaaatttgagtattcattcattgtatgaatcgcaaatgattctcacaacaatattagatcgaatgcagcggaaacttgacaaatgtcttaggggcattggtaaaagtaggcaagaaccaattactactgacacagatacgcaaaatttacaatatccaaacgagcatcgaaatagggcaaactcagatgatgatctgacaacacagccaggaccagacaaaagcttgacaattgaagaatatgctgccagaattcatacgatcaagctccgcattgtaaaaattcatgacacattggaccacgtggaaaagaagattgcgcagataaatacgaatctttcctccgcctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]