2024-04-18 12:58:47, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_038935632 849 bp mRNA linear PLN 12-FEB-2021 DEFINITION Alternaria burnsii uncharacterized protein (GT037_010585), partial mRNA. ACCESSION XM_038935632 VERSION XM_038935632.1 DBLINK BioProject: PRJNA691329 BioSample: SAMN13783390 KEYWORDS RefSeq. SOURCE Alternaria burnsii ORGANISM Alternaria burnsii Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae; Pleosporaceae; Alternaria; Alternaria sect. Alternaria. REFERENCE 1 (bases 1 to 849) AUTHORS Feng,Z. TITLE Draft Genome Sequence of Cumin Blight Pathogen Alternaria burnsii JOURNAL Unpublished REFERENCE 2 (bases 1 to 849) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (12-FEB-2021) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 849) AUTHORS Feng,Z. TITLE Direct Submission JOURNAL Submitted (13-AUG-2020) College of Plant Protection, Northwest A&F University, Taicheng No. 3, Xianyang, Shanxi 712100, China REFERENCE 4 (bases 1 to 849) AUTHORS Feng,Z.H.Z. TITLE Direct Submission JOURNAL Submitted (09-JAN-2020) College of Plant Protection, Northwest A&F University, Taicheng No. 3, Xianyang, Shanxi 712100, China COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_024066129). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..849 /organism="Alternaria burnsii" /mol_type="mRNA" /strain="CBS107.38" /host="Cuminum cyminum" /type_material="culture from type material of Alternaria burnsii" /db_xref="taxon:1187904" /chromosome="Unknown" /country="India:Maharashtra" /lat_lon="16.42 N 74.28 E" /collection_date="1938" /collected_by="Uppal, B.N." gene <1..>849 /locus_tag="GT037_010585" /db_xref="GeneID:62208810" CDS 1..849 /locus_tag="GT037_010585" /codon_start=1 /product="uncharacterized protein" /protein_id="XP_038781636.1" /db_xref="GeneID:62208810" /translation="
MVVSPLFLEPVSCAPVETRLAAIRAALSEGFSPNELDRRPRGVGRPLDWAIEDGAAADYAHLKQNLAIVHLLLGAGADPRLPSRYPFGWSPIDSLEAWFEQYKIRPQDFPPEVLVLKPFYEKALEAMRRVADELDAKEVAEAAREAQKEGSLLEYNHAGRDQRVRNLETASGKVMLTYNNDIFKDGNMAAYQVWARAQVNDGVKLVNSAINSAMTGMDFCSLMHDLVLYADCGPLGYIRPDFLEETCDFEMLGLDLNELFYSKLAYWAFPIVLFVHVYTHYK"
misc_feature 256..>555 /locus_tag="GT037_010585" /note="Uncharacterized protein conserved in bacteria (DUF2184); Region: DUF2184; cl41931" /db_xref="CDD:455276" ORIGIN
atggtagtaagccccctctttctcgagccggtatcctgcgcacctgtggaaacccgcctcgcagctatacgtgctgctctatctgaaggcttctctcccaacgaactggaccggcgcccccgtggcgtaggtcgcccactggactgggcgatcgaggatggcgctgccgccgattacgcccatctcaagcaaaacctcgcaattgtccatctactccttggggccggagctgatcccaggcttccttctaggtatccttttggctggtcgccgattgattccctggaggcttggttcgagcaatataagatcagaccgcaggacttcccaccggaggtattggtgttgaaaccgttctacgagaaggcactggaagctatgagaagggttgccgatgagcttgacgcaaaagaagtcgctgaagccgccagagaagctcagaaggagggctcgttgcttgaatacaatcatgctggcagagaccagagagtacggaaccttgaaacagcaagcggcaaggtcatgttgacctacaacaacgacatcttcaaggacggaaatatggctgcataccaagtctgggccagagcgcaagtgaatgacggcgtgaagctggtcaacagcgctatcaactccgcaatgacggggatggatttttgttccttgatgcacgacctggtgctatatgctgattgtggtcctctaggatacattcgacccgatttcctcgaggaaacgtgcgatttcgagatgcttggactggacttaaatgaacttttctattcaaagctcgcgtactgggcttttccgattgtgttatttgttcatgtatatacacattacaagtag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]