GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-18 12:58:47, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_038935632             849 bp    mRNA    linear   PLN 12-FEB-2021
DEFINITION  Alternaria burnsii uncharacterized protein (GT037_010585), partial
            mRNA.
ACCESSION   XM_038935632
VERSION     XM_038935632.1
DBLINK      BioProject: PRJNA691329
            BioSample: SAMN13783390
KEYWORDS    RefSeq.
SOURCE      Alternaria burnsii
  ORGANISM  Alternaria burnsii
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae;
            Pleosporaceae; Alternaria; Alternaria sect. Alternaria.
REFERENCE   1  (bases 1 to 849)
  AUTHORS   Feng,Z.
  TITLE     Draft Genome Sequence of Cumin Blight Pathogen Alternaria burnsii
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 849)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (12-FEB-2021) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 849)
  AUTHORS   Feng,Z.
  TITLE     Direct Submission
  JOURNAL   Submitted (13-AUG-2020) College of Plant Protection, Northwest A&F
            University, Taicheng No. 3, Xianyang, Shanxi 712100, China
REFERENCE   4  (bases 1 to 849)
  AUTHORS   Feng,Z.H.Z.
  TITLE     Direct Submission
  JOURNAL   Submitted (09-JAN-2020) College of Plant Protection, Northwest A&F
            University, Taicheng No. 3, Xianyang, Shanxi 712100, China
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_024066129).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..849
                     /organism="Alternaria burnsii"
                     /mol_type="mRNA"
                     /strain="CBS107.38"
                     /host="Cuminum cyminum"
                     /type_material="culture from type material of Alternaria
                     burnsii"
                     /db_xref="taxon:1187904"
                     /chromosome="Unknown"
                     /country="India:Maharashtra"
                     /lat_lon="16.42 N 74.28 E"
                     /collection_date="1938"
                     /collected_by="Uppal, B.N."
     gene            <1..>849
                     /locus_tag="GT037_010585"
                     /db_xref="GeneID:62208810"
     CDS             1..849
                     /locus_tag="GT037_010585"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_038781636.1"
                     /db_xref="GeneID:62208810"
                     /translation="
MVVSPLFLEPVSCAPVETRLAAIRAALSEGFSPNELDRRPRGVGRPLDWAIEDGAAADYAHLKQNLAIVHLLLGAGADPRLPSRYPFGWSPIDSLEAWFEQYKIRPQDFPPEVLVLKPFYEKALEAMRRVADELDAKEVAEAAREAQKEGSLLEYNHAGRDQRVRNLETASGKVMLTYNNDIFKDGNMAAYQVWARAQVNDGVKLVNSAINSAMTGMDFCSLMHDLVLYADCGPLGYIRPDFLEETCDFEMLGLDLNELFYSKLAYWAFPIVLFVHVYTHYK"
     misc_feature    256..>555
                     /locus_tag="GT037_010585"
                     /note="Uncharacterized protein conserved in bacteria
                     (DUF2184); Region: DUF2184; cl41931"
                     /db_xref="CDD:455276"
ORIGIN      
atggtagtaagccccctctttctcgagccggtatcctgcgcacctgtggaaacccgcctcgcagctatacgtgctgctctatctgaaggcttctctcccaacgaactggaccggcgcccccgtggcgtaggtcgcccactggactgggcgatcgaggatggcgctgccgccgattacgcccatctcaagcaaaacctcgcaattgtccatctactccttggggccggagctgatcccaggcttccttctaggtatccttttggctggtcgccgattgattccctggaggcttggttcgagcaatataagatcagaccgcaggacttcccaccggaggtattggtgttgaaaccgttctacgagaaggcactggaagctatgagaagggttgccgatgagcttgacgcaaaagaagtcgctgaagccgccagagaagctcagaaggagggctcgttgcttgaatacaatcatgctggcagagaccagagagtacggaaccttgaaacagcaagcggcaaggtcatgttgacctacaacaacgacatcttcaaggacggaaatatggctgcataccaagtctgggccagagcgcaagtgaatgacggcgtgaagctggtcaacagcgctatcaactccgcaatgacggggatggatttttgttccttgatgcacgacctggtgctatatgctgattgtggtcctctaggatacattcgacccgatttcctcgaggaaacgtgcgatttcgagatgcttggactggacttaaatgaacttttctattcaaagctcgcgtactgggcttttccgattgtgttatttgttcatgtatatacacattacaagtag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]