GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 06:24:23, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XM_035795708            7057 bp    mRNA    linear   VRT 12-AUG-2020
DEFINITION  PREDICTED: Oncorhynchus keta testis and ovary specific PAZ domain
            containing 1 (topaz1), transcript variant X7, mRNA.
ACCESSION   XM_035795708
VERSION     XM_035795708.1
DBLINK      BioProject: PRJNA655759
KEYWORDS    RefSeq.
SOURCE      Oncorhynchus keta (chum salmon)
  ORGANISM  Oncorhynchus keta
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Protacanthopterygii;
            Salmoniformes; Salmonidae; Salmoninae; Oncorhynchus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_050125.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Oncorhynchus keta Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..7057
                     /organism="Oncorhynchus keta"
                     /mol_type="mRNA"
                     /isolate="Oke142-1_Chum_Gynogen"
                     /db_xref="taxon:8018"
                     /sex="female"
                     /tissue_type="Whole body"
                     /dev_stage="juvenile"
                     /country="Canada: Inch Creek, BC near Abbotsford"
                     /linkage_group="LG20"
     gene            1..7057
                     /gene="topaz1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 ESTs, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     2 samples with support for all annotated introns"
                     /db_xref="GeneID:118399541"
     CDS             1707..6026
                     /gene="topaz1"
                     /codon_start=1
                     /product="uncharacterized protein topaz1 isoform X5"
                     /protein_id="XP_035651601.1"
                     /db_xref="GeneID:118399541"
                     /translation="
MRLVYVHGDLMEQKHSSPSEPELDPGIAIASLEDSGTMSEMPCEVPPHLHTSHVLRSHSNATDAPVRSHHFMTQDGGWRGGPGGGDSSLESPANGTLSPWSVENGVGVDPPSDSDTEDQDLFSCRRVVAYIKRLHLSCARTYLSWPFPKPDSAQSLSVTSSVLNANGSLTPPVEVNGYGDSLVRAERTRVLTSHCTLTEYTPQTSYQVYAHRNGMKGEGNMMEEKDMSNGRGGEEDESVTQCSLSPDTSSKVYPSHPLCNKKPQSQLRTRGLHRNKASISPPPKAPTISALLTPPKNHSETDPILSVSSNLSQTDTDTVSCLSPPKTDSVSTFPPAKVSGGGETASTPPPIGVGSDIATAAFLLFSSASQNIETSPPPPSPTPSSLTPSSPRRKDEGGAMFNATSSPSAVDSKTDTSHSNSFHSAESSPLPPDLSCLSAESSFLSSSSSLLPQEKRKAEGVEVQSREGDEIKGEAAASGELKVLVLPGSESSSPEKQEHQRPEQKSTQGGSSLGKPKEGEAVVATISNLAPGILGGQTPMLCITRLMLQTQSYSEEDDDFVDQKEKLSSAVGVGTQAQASSTDEDDGTCGEEGTLEPVRTQPCTDEDDVDHHNQSKVTSENQESGTPSSSGSHTQHQEVEVRAGSKVKLASDPKAHLLDEFTAYEQDILLVDVLLDDPELFGSLPQDLEPMLGSTRGRRAPRARTTIGAGRALLLTGAGPSWATEKSSPTGTDGPPGFKTDQRRIIHFKDEESAGRSWRPEASSNPKPALVHSNSWPPTVHALHPDQGGTDYNYSPMKAEISERAQAFQSLNSFKSTLPYLMTGDSWCNGHTTSCEDPAAADTGPQRQFDSYCKYYFSMSDCFHKTCWFLHVPKRGDEKFCVETVLRFVRSSNPVCLQRAVSVFTSYYQFSPPGVYHTPLVLNSLLAALLKAGFLSDIITVLHVSTAHNILPSPAFLLALFDYVGERDQSILPELIQLTSKMVDAGLGLNVDQCERVLHMFLQSPQYHPADSPENYTTKPGNHRSMNTDAPTPEALSLAHALVELCSQQEDWGRLGVVFRSICHSHRSLVDLQHFSGCVAIALLEGDKDRLALPFASFTETVYQETEDWDDGLIKSFLGRIGVSLMFRYHKTQQWAKGRRLVDVLSRLKVNYSTLKGLFGNEDGASRCHLITIATELFLRGDSVEGALNTLRDNEWFLSSCVWPCSVEDVAERTTVLVRLAEITSHRDTLEVLTNLPGLKEPADLADISIYSCLFNSHLKSCVDRQTVTVASDTLGFMLSKNLAVDPPLLHTLLHKLGKQNIWLRARALFKQALCLGYYPGVKSVPGSLALTVPCSLGEIEIALAFEMVLTFNATTILNTTGTPQSIIITLKRTGDRESEYLAAGSRLLSAAIVPNPKLTVHYTAVNSCQEQLFTVDTHTARRWLRHNHTWANEVWTHS"
ORIGIN      
ctatgcgcatgcccagtaggatagcatcaagctccgctgcaacaggtgtgatttaaatggggagtgaggcagggaacgctagcctggacaggctctacataacattttcaattaacgagaacgtttgaaaccagagttgtttgtaagaataatttgtgtaaacaagtcgtgtagggctactaatttcggtgacattcttatcacgtagccctactaaatctcaatttgcatcgaaattgagtggagcgattttcgcctactagccagcgtctgaatttgacatttgtgttatttattatccgacaaatagttatagcccgtgcatggtatttcccgttgcctaagttaaacttacgtttattttattagtgggaagagaattttggtttacattttttctttcaaagttagcttttgaacagatttttttcagcaaggtttatcaaactctaataacgcattgacaaaaagtaaagaaaaaacgatatatttttcgtgttcgctgataaaatagctctgaaatgcgaccatgctcccatctaccgggagggtcaaattaaatcgaagcgtgctgaaagttgaaggcaataatggactgccaagcgtgcccagacggagacgaccattcaaagtgttgtactcgccaaccggcgatacacatggcgatcctaacagcatcagggaaactctggaatgctcttcacaaaacgaggaaaacagcgaattgaaaacgaaggatgattttgttttggggtacactgaatccacagttttgaagtccgaaaatcataatttccccccatacttggggacagaaaaggggcaccttgtgagtgagacagctgtcggaaaaacaactgcggtgccagcagacagtggggaacagaggtcaccaccattgactgaatgtgaaggtatggagctgtactttaaataaaatggccatttgagcactgggaatgattttgaggtgaaagtagatgggccatatactagaagcaaatatgtccaggctaaagtcgggggacctcacacaagaaggaaatgatcaatttggccgaatagggtgacagcggggcataagaaagaattgttgcaggctgcagttcgcggtgtcctttggcagtgagggctccaacgaactgactgataaaatcaatacttttaaccaagcaatttccaagggtaaaaactctaggcacgtttcttattacatagagagcgacctttcttattacatagagagcgacctatcggtgaagtccagagtgagagcgtggcaagtctccaacgacattggccaagaaaactagaacatctgtgctgagaagaacacgatcaatagagcgcaggaggaacgtctcttgtttagagtcagacaaggcagttgaagagcagtctccagcgcagtcacgaaaaagaaccaataaccgggtgagtgctgctttgaaacttgcgaaggaaagtttgaagttgagaacttacgatctgcaacaagtgcagggacagaacgaggaggtgcagaatctaccgaaggggatgccggccacgctgtaaaaagggcaatctccctacttaatgggatttcaagtaagcagcaggtgagcagggggtcaagcggggctggaacgcatgacagaggcattcttgaagactctggaacaggaagtgatgacgtagaaacaggaaagccatttgctaagcggatgagattggtttatgtccacggagacctaatggagcaaaaacattctagtccaagtgaaccagaactggatcctgggatagctatcgcttcccttgaagacagtgggacgatgtctgagatgccatgtgaggtcccgccacatttacacacaagtcatgtccttcgtagtcatagcaacgctacagatgctcctgtgagatcacaccactttatgacacaggatggaggctggaggggagggcccgggggaggtgacagttcactggagtcccctgccaacgggacgctgtctccctggtccgtggagaacggagtgggagtagaccccccctctgacagcgacactgaggaccaagacctgttctcctgtcgtagagtggtggcctacatcaagaggctgcacctgtcctgtgcacgcacctacctctcctggcccttccccaaacctgattctgcacagtcactctctgtgacatcatcagtcctcaacgcaaatggatcactgacacccccagtggaggtgaacggatatggagactcactggtgagggctgagagaaccagagttctcacctctcactgtacactcactgaatacactccacagacaagctaccaggtctatgctcataggaatgggatgaagggagagggaaacatgatggaagagaaagacatgagcaatggaagaggaggagaagaggatgagagcgtgacccagtgttcactctctcctgacacttcaagcaaggtgtacccatcccatcctctctgtaacaagaagccacagtcccaactcagaactaggggtctccatcgcaacaaagcttccatatcccctccacctaaagctcccaccatctccgccctcctcaccccacccaaaaaccacagtgaaactgatccaattctttcagtttcctccaacctttctcaaactgacacagacactgtttcttgcctctctccacccaaaactgactctgtctcaaccttccctccagctaaagtcagtggcggtggtgagacagcctccaccccccctcctataggcgttggtagtgacatagccactgccgcctttctgctgttctcatctgcatcccaaaacatagagacatccccaccacccccctctcctactccctcctctcttactccctcctcccctcggaggaaggatgaaggtggggctatgttcaatgcaacatcctccccatcagctgtggacagtaagactgacacctctcactcaaactcctttcactcagcagagtcatcccctcttccaccagatttatcctgtctttcagctgaatcctcctttctctcatccagctcctcacttctgcctcaagaaaaaagaaaggcagagggagtggaggtgcagagcagagagggagatgaaattaaaggagaggcggctgcgagtggagaactgaaggttttggttttaccaggcagtgagtcctccagtccagagaagcaggagcaccagcgtccagagcagaagagcacacaggggggctcgtcgcttggcaagcccaaagagggagaggctgtggtggccacgatcagtaacctcgcccctgggattcttggaggtcaaacaccaatgctgtgcataacacgcctgatgctgcagacacagagctactcagaagaggatgatgactttgtagaccagaaagagaagttgtccagtgcagtaggtgttggaacacaggcccaggcatcctccactgatgaagatgatggtacatgtggtgaagaggggacactagagcctgttagaacccagccctgtactgatgaagatgatgtcgatcatcataatcagtccaaggtcacgtctgagaaccaggaatccggcactccttcctcttccgggtcacacactcaacaccaggaagtagaagttagggcagggtcaaaagtcaagctggctagtgaccccaaagctcacctcttggatgagttcacagcctacgagcaggacatcctgcttgtagatgttctcctagatgacccagagctgtttggcagcttgcctcaggaccttgaacccatgctggggtcaaccaggggacgaagggcccctagagccaggaccaccattggggcagggagagccctactactcacgggtgcaggtccctcatgggccactgagaaaagctcccccacgggtacagatgggcctcctggttttaagactgaccagagaagaattatccactttaaagatgaggagagtgcaggacggtcttggagacctgaagccagctccaaccctaagcctgccctggtccacagcaacagctggccccctactgtccacgcgttacatccagaccagggtggaactgactacaactacagtcctatgaaggcagagatctctgagagggcccaggccttccagtctctgaactcatttaagagcacactgccttatctgatgactggagactcctggtgcaacggacatacaacctcatgtgaagacccagcggcagcagacactggccctcaaagacaatttgacagttattgcaagtactatttcagcatgtcggactgtttccataagacctgttggttcctccatgtgcccaagagaggagacgagaagttctgtgtggagacggtgttgaggtttgtcaggtcttccaaccctgtctgtctgcagagggcagtgtcagtgtttacgtcgtactaccagttcagtcctccaggtgtctaccacacccctctggtcctgaattctctcctggccgctctgctcaaagctggctttctgtctgacatcatcacggtgctgcacgtcagcactgcccacaacatactgcccagtccagcgtttctcctggctctgtttgactatgtgggagagagagaccaatccatcttacctgaactcattcaactcacctctaagatggtggatgcaggcttggggttaaatgtggaccaatgtgagcgtgtcctacacatgttccttcagtcgccacaataccacccagcagactcacctgagaattacacaactaaacctggcaaccacaggtcgatgaacaccgacgctcccactcctgaagcgctgagtctggcccatgctctcgtggagttgtgttcccagcaggaggactgggggaggttgggtgtagtcttccgctccatatgccactcccacagaagccttgtcgacttacagcacttcagcggctgcgttgccatcgcgctgctcgagggggacaaagacagactagccctgcccttcgcctccttcactgagacagtgtaccaggagacagaggactgggatgatggtctgatcaagagcttcctggggagaataggagtctctctgatgttcagataccacaagacacaacaatgggccaagggccggaggctggtggatgtgttatccaggttaaaggtaaactactccactctgaagggactgttcggcaacgaggatggagcttctcgctgtcacctgatcacaatagctacagaacttttccttaggggcgacagtgttgagggggcactcaatacactccgagataacgagtggttcctgagttcgtgtgtgtggccgtgttcggtggaggacgtagcggagagaacaactgttctggtacgactggctgagataacatcccacagagacacactggaggtcctcactaacttgcctggtcttaaggaacctgcagacctagcagacatctccatatacagctgtctgttcaacagtcacctcaagtcatgtgtcgacagacaaactgtgactgtagcctcagacacgctgggtttcatgttgtctaagaacctggctgtggaccctcctctgctgcacactctgctgcacaaactgggcaagcaaaacatctggctacgggctagagctctcttcaaacaggccctgtgtctaggctattaccctggtgtgaagtccgtgccaggctctctagcactgaccgttccctgttccctgggggagattgagatagctctggcctttgagatggtcctcaccttcaatgctacaaccatcctcaacacaacaggcacaccacagtccatcatcatcacactcaagagaacaggggaccgtgagagtgagtacttggcggcaggcagtcgcctcctctcggcagcgatcgtccccaaccctaaactgaccgtccactatacagcggtcaactcctgtcaggaacagctgttcacggtcgacacacacaccgcacgccgctggctccgacacaaccacacctgggccaacgaggtctggacacattcctaaaaataagtgttccaggaatactgacctacgttcccttcctgggaataccaggaaggtttggaacaggacaaggttgtactgaacacttccatggctgtgtgtgtgacactcttcgaagtttaacctgcagcatctagactttacaggctgatctgatcaagggatttatatcaagaaaagactatcagaactgcatataattgttgtgagttttttacaaaacttaattgtatgttgaggttcttcattgtaagtcgttttaatttaaaggaaatgttgaatggaggcgaaagtacgaactttccaagtttgtttggctttgactagattttgtttgaaaaatgtggtttatttgaaagttctctaattttagcttgatttagcttgattgtctttaaacactttttgttgcacatttctgaggcacttgaacaattgtgaagctagattttactgttttgtaagaaatgtaaaaaagattaaagaatgtcgctattgaacttgactacaaggtttgtttcagaaaatgtttattttccttagaatttgtttctaggcagatttaaaagcctaagatgttttattttgagtcagtcagctctttcagtaatactacattttaatggaataaattcacaacagtactattattattgtaaagaaacaagcgtgtcccaactctatgatctcactgattgagacagacattttgatcccagttaacctaatggtcccagctggaatcacatcagtgtttacgacatccctgatttctttacattcctattctgtttccttttccagtgcaaaatcattcaattcttctcgtgcttcaaagtgattgtcgagaacctggttctctgttctaagtctatcgccggttctagcgatgaacagtatttcagcatcttctactgtaggtatgtttggttgtgtaaaacacattgttttctggaacaacagtctagaagcttctatttagttttagtcttgtatttcttaaaggaaaaataaactactactgacttgtg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]