2024-04-27 04:04:25, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_035620582 2774 bp mRNA linear VRT 01-APR-2022 DEFINITION PREDICTED: Scophthalmus maximus argonaute RISC component 4 (ago4), transcript variant X4, mRNA. ACCESSION XM_035620582 VERSION XM_035620582.1 DBLINK BioProject: PRJNA821077 KEYWORDS RefSeq. SOURCE Scophthalmus maximus (turbot) ORGANISM Scophthalmus maximus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Carangaria; Pleuronectiformes; Pleuronectoidei; Scophthalmidae; Scophthalmus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_061536) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Scophthalmus maximus Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2774 /organism="Scophthalmus maximus" /mol_type="mRNA" /strain="ysfricsl-2021" /db_xref="taxon:52904" /chromosome="22" /sex="female" /tissue_type="muscle" gene 1..2774 /gene="ago4" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 91 samples with support for all annotated introns" /db_xref="GeneID:118291986" CDS 177..2774 /gene="ago4" /codon_start=1 /product="protein argonaute-4 isoform X4" /protein_id="XP_035476475.1" /db_xref="GeneID:118291986" /translation="
MEALGPGCSVGEDITDSQPGNSAVADKGAPAPASLFQPPRRPGLGTVGKPIRLLANHFQVQIPKIDVYHYDIDIKPEKRPRRVNREVVDTMVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDLEVTLPGEGKDQTFKVSLQWVSVVSLQMLLEALSGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPVIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNDMTEVTGRVLPAPMLQYGGRVSTDTGRDCGRGLSPQNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKMSYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQDMSQEQLFSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCSDKAERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKDHDR"
misc_feature 321..710 /gene="ago4" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 741..893 /gene="ago4" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 894..1256 /gene="ago4" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(1050..1052,1095..1097,1137..1139,1149..1151, 1203..1205,1224..1226,1230..1232) /gene="ago4" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1395..2750 /gene="ago4" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1854..1856,1866..1868,1902..1913,1920..1922, 1944..1946,1953..1955,1965..1967,1977..1979) /gene="ago4" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(2058..2060,2064..2066,2304..2306,2718..2720) /gene="ago4" /note="active site" /db_xref="CDD:240015" ORIGIN
aggcagcagaagcggtagctcggctctgttggttcaggcagcagtcgtccacgcatctatctatatttcccatttttcttaaattagcccctttaagcttcgcgataccgcccccaatttcagcgacggtacggagccgccaggccgggactgagacggagagagaggcctcggccatggaagccctcggacccggttgttctgtcggagaggatataacagacagtcagcctggtaactcggcggtggctgataaaggagcaccagctccggcctctctgttccagcctccacggcgtcccggccttggcacggtggggaaacccatccggctccttgccaaccactttcaggtgcagattcccaagattgatgtctatcactatgatatcgacatcaagcctgagaaacggcctcggagggtcaacagggaggtggtggacaccatggtgcggcacttcaagatgcagatctttggagaccggcagcctggctacgatgggaagaggaacatgtacacagcacatccactgccaataggaagagacagggtggatctggaggtgaccctgcccggcgaggggaaggatcagacgttcaaagtgtctttgcagtgggtgtccgtggtcagtcttcagatgctactggaggccctctcaggccacctgaacgaggtccccgaagactcggttcaggccctggatgtcatcacgcggcacctgccttccatgaggtacactccagtggggcgttcatttttctcccctccggagggctactaccatcccctcggtggaggcagggaggtgtggtttggttttcatcagtctgtccgtcctgccatgtggaacatgatgctcaacatcgacgtgtcggccactgctttctaccgcgctcagcccgtgatagagttcatgtgcgaggtgcttgatatacagaacatcaacgaacagaccaaaccgctgacggactcgcagcgtgtcaaattcaccaaggaaataagaggcttgaaagttgaggtcacacattgtggtcagatgaagaggaagtatcgtgtgtgcaatgtcacgcgccgacctgccagccaccaaacgttccccttacagcttgagaacggccaagccatggagtgcacagtagctcagtatttcaagcagaagtacaatctgcagctcaagtatccacatttaccctgtctgcaagtggggcaggaacagaagcacacctatcttcccctggaggtctgcaacatagtcgcaggccagcgctgtatcaagaaactgacagacaaccagacatccaccatgattaaagcaacagctcgctcggcccccgacagacaggaagagatcagcagactggtcaaaagcaacagtatggttgggggcccggacccttacctgaaggaatttggcattgtggtgcacaacgacatgacagaagtgacagggcgtgttctcccagcgcccatgctgcagtacgggggccgggtgagcacggacacaggacgggactgtggcaggggactctctccgcagaataagacggtggccacgcccaaccagggcgtgtgggacatgagagggaagcagttctacgccggcatcgagatcaaggtctgggccgtggcctgtttcgcccctcagaaacagtgtcgagaggacctgctcaagagcttcactgaccagctgcgaaagatctcaaaggatgctgggatgccaatccaaggccagccgtgcttctgtaaatacgcccaaggagccgacagcgtggagcccatgttcaaacacctcaaaatgtcttacgtgggtctgcagctgattgtggtcattctgcctggcaaaacacctgtctatgctgaggtgaagcgggtgggagacacgctcctcggcatggccacacagtgtgtccaggtgaagaacgtagtgaagacgtcccctcagaccctctccaacctctgcctcaagatcaacgccaagctgggaggcatcaacaacgtcctggtgcctcatcagaggccctccgtgttccagcagcccgtcatcttcctgggcgccgacgtgacccatcccccggcgggcgacggcaagaagccgtccatcgctgcagtggtgggcagcatggacggccaccccagcagatactgtgcgacggtgcgagtccagacgtcacggcaggacatgtcccaggagcagctcttcagccaggaggttatccaggacctgaccaacatggtgcgggagctgctcatccagttttacaagtccacgcgcttcaagcccacccgcatcatctactatcgtggcggcgtgtccgagggacagatgaaacaggtagcgtggccagagctgatagccatccgaaaggcttgcatcagtctggaggaggattatcggccgggcatcacctacatcgtggtccagaaacgacaccacactcgtctcttctgctctgacaaagccgagagggttgggaagagcggtaacgtcccagctggcaccacggtggacagtaccatcacacacccgtccgagttcgacttctacctgtgcagccatgctgggattcagggaaccagccgtccctcccactaccacgtcctgtgggacgacaactgtttcacggctgacgagctgcagctcctcacctaccagctgtgccacacctacgtccgctgcactcgctccgtctccatcccggcgccggcctactacgcccgactggtggccttccgagcccgctaccacctggtggacaaagaccatgacaggtga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]