GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 05:12:40, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XM_035549658            3750 bp    mRNA    linear   VRT 20-JUL-2020
DEFINITION  PREDICTED: Cygnus atratus testis and ovary specific PAZ domain
            containing 1 (TOPAZ1), mRNA.
ACCESSION   XM_035549658
VERSION     XM_035549658.1
DBLINK      BioProject: PRJNA646059
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Cygnus atratus (black swan)
  ORGANISM  Cygnus atratus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Anseriformes;
            Anatidae; Anserinae; Cygnus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_023336611.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Cygnus atratus Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 39% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..3750
                     /organism="Cygnus atratus"
                     /mol_type="mRNA"
                     /isolate="AKBS03"
                     /db_xref="taxon:8868"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="stomach"
                     /dev_stage="adult"
                     /ecotype="Queensland, Australia"
                     /country="Australia: Queensland"
                     /collection_date="21-Dec-2018"
     gene            1..3750
                     /gene="TOPAZ1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 3% coverage of the
                     annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:118249575"
     CDS             1..3750
                     /gene="TOPAZ1"
                     /codon_start=1
                     /product="protein TOPAZ1"
                     /protein_id="XP_035405551.1"
                     /db_xref="GeneID:118249575"
                     /translation="
MQKESSPIKSSLLFNEVKSQHKKGYVSCHQSQSNKFLSEKESNIGRKRAKKMKISEMSAGQNVFTNGANECTKCELKTEDATSSSSAVFGLKHKEMTLSDSWDCTDDLHTGNNTREAQEASAQRKNSTKSLAFEGGFKKTSKLSVVAKGEASSCEAPQWHSAASGSLRALTQARGVSNCHESMTGGKLNKVNKKLRQFTCQRTIPMTGKNVWPRESCARTSEWVPKNHWSISEGKRLLSPVFEESSDKSSVKAVGNSAVTENSRQLDLCTSLAKVKERAHNAVDLNAKCLTSVETSGSSSMDIDETCGMSNENVESPVTMVTSAVAFNPDDMQEVKATSNFTAKPKNKNKGAVTKRSPSVTVQNNTSTSNKSRINLSCKASVVNQTLSDVKLMKALNTRNLTNFRIPLRRNKPECRKLECISSSERKTCSPLELLDSASVSQRQKRGEETWVNSEQQPLPVVSDATSTASMKKNTGKINSKDLHHDGSETLSNEMPTLPEHASLYPCPAPERQLESSPCGFSAAQCVWKSNFPEHSGNAVDHPVALEIHSGGKSRVNRSQPESDFFPDILEAYKEDVLVIDVIQDDPDLFGTNDEEELTLTACDNWPTKASCSSIFIKEEKQNLKPEYAVISENRGSASHSVQQILGMIDLPRKYCRYYFMTLRGCERAKCWFRHVPEQRHEKICMAILKTYISIKEKGLLKRAVQIFVRYYREVTPGEDFAFQVLNDLLVCLLKNCLLQEVFQILRVAVQVNTLPAVDVLLKVFEHVASLNIRNAVPKLISTFRKLIDAGMFLEFEHFNYITKLLQQLQVSSQEINVVLNIKSRFQERHFKSNWLFDCNLVMIEIQHCKEKNDWSKMGTLYVNARTGCEHFDDLQKLSLCIAEILTRDSEKDRPGVPFCDFADAVITSLTCNEADRIFIGRTGISMMNSYRKVLQWRKGRTVLDKLHELQINFTVLKGLIGAENLASRCQIVNNAAEIFLKTGSLDGATWVLRESEWTTNTPLWPCDEEDILNRHNLLCSLVHKYMRQSLYRQALEVLQNLPGVQNSSDTVDVSQYSCVFNLLIKACFESKNLGVSSSAVDFMLSKNIAVDFFLLRGLITGLGRSCLWSKARTYYKTALSLGCYLPLEGNLHHKILPIPFYVSEVEMLLAIELFLVSNASDIQSPGATTQSLQIILKRCEDQTVQSNSDYQAGMERLSLAAHVSDPKLFLKRMTVNVNMEEVYSLEHTSALKWLQENMKWAGKVWLFQ"
ORIGIN      
atgcaaaaagaaagctcacctataaaaagtagtttattgtttaatgaagtgaaatctcaacataaaaaagggtatgtttcatgccatcagagtcaaagcaataagtttttaagtgaaaaagaatcgaatattggtagaaagcgtgcaaaaaagatgaaaatcagtgagatgtcagcagggcagaatgttttcacaaatggggctaatgaatgcactaagtgtgaattaaagacagaagatgccacatcaagctcctctgctgtctttggactaaagcataaagaaatgactctgtcagattcatgggattgtacagatgatcttcatacaggaaacaatactcgtgaagcacaagaggcatcagcacagaggaagaatagtaccaaatcacttgcatttgaaggtggctttaagaagacatctaagctctcagtagtagcaaaaggagaagcttcaagctgtgaggcaccacaatggcactctgctgcctcgggcagtctgagagcactaactcaggcccgtggtgtttctaattgtcacgaaagcatgacaggtggaaaactgaataaagttaataagaaactgcgtcagtttacctgtcaaagaacaatacctatgactggtaaaaatgtttggcctcgtgaatcttgtgccaggacttctgaatgggttcctaaaaatcactggtccatctcagaaggaaaaagacttctaagtccagtcttcgaggaatcctctgataaaagcagtgtcaaggctgtaggaaacagtgctgtgacagaaaattcaaggcagttggatttatgtacatctctggcaaaagttaaggagcgtgcacataatgcagtggatctaaatgctaaatgcctgacttcagttgaaacatcaggatcctcttctatggatattgatgagacttgtggaatgagcaatgaaaatgtggaatcaccagttactatggttactagtgctgtggcttttaaccctgatgatatgcaagaagttaaagcaacctcaaattttacagcaaaaccaaaaaataaaaacaaaggagctgtaacaaagagaagcccatctgtgacagtccagaataatacatctacaagtaacaaaagcagaataaacttaagctgtaaggcatcagttgtgaaccagacgctttctgatgtaaaactaatgaaagcattaaacaccagaaacctgacgaatttcagaattcctttacggagaaacaaacccgaatgcaggaaattggaatgtatcagttcatcagaaagaaaaacctgtagcccactagagctccttgacagcgctagtgtttcgcaaaggcagaaaagaggtgaggagacttgggtaaattctgagcagcagccccttcctgtagttagtgatgctacatctacagcttccatgaagaaaaatactggtaagatcaacagtaaggacttgcatcatgatggctctgaaaccctttcaaatgagatgcccacgctccctgaacatgcctccttatatccgtgtcctgctcctgagaggcagctggagtcatctccatgtggcttcagtgctgctcaatgtgtatggaaatcaaattttcctgagcattcagggaatgcagttgaccatcccgttgcattagaaatacatagtggtggcaaatcaagagtgaatcgttcacagcccgaaagtgatttttttccagatattcttgaagcttacaaagaagatgttcttgtcattgatgtgattcaggatgaccctgatctttttggaaccaatgacgaagaggagcttacactcacagcctgtgataattggcccacgaaggcatcctgtagtagcatcttcattaaagaagagaagcagaatcttaagcctgagtatgctgttatttcagaaaatagaggttcagcttctcattcagtccagcagatcctggggatgattgatttgccccgtaaatattgcagatactatttcatgactttgcgtggctgtgaaagggcaaaatgttggtttcggcatgttcccgaacaaagacatgaaaagatttgcatggcaatacttaagacatacattagtatcaaagaaaaaggccttctaaaacgtgcagtccaaatatttgtcaggtattacagagaagttactcctggtgaggattttgcttttcaagtgctgaatgatcttctcgtttgtttgctcaagaactgtttgttgcaagaagtatttcagatactgcgtgtagctgtacaggttaatacactgccggctgtggatgttcttctgaaagttttcgagcatgtggcttctttgaatataagaaatgctgtgcctaaattaatcagtacctttcgtaagctcattgatgctggcatgtttcttgagtttgaacattttaattacattactaaactccttcaacaattgcaagtttccagccaggaaataaatgttgttttgaacataaaatccagatttcaggaaagacattttaaaagcaactggctctttgactgcaatttggtaatgattgaaattcagcattgcaaggaaaaaaatgattggagtaagatgggaactttgtatgttaatgcaagaaccggatgtgaacattttgatgaccttcagaaattgtctttatgtattgctgaaatactaacgagagattctgagaaagacagaccaggagttcctttttgcgattttgctgatgcagtaataacaagtttgacatgtaatgaagcagacaggattttcattggaaggactggcataagcatgatgaattcttatcgcaaagtactacagtggagaaagggaaggacggttttggataaattgcatgagctacagataaattttacagtcttgaaaggacttattggtgcagagaacttagcatcaagatgtcaaattgttaataatgctgcagaaatttttcttaaaactggaagtttggatggagcgacatgggtattgagagagtcagaatggaccacgaatacaccattgtggccctgtgatgaagaggacatcctcaatcgacataatctgttatgttcactagtgcacaagtacatgaggcagagtttatacaggcaggcattggaagttcttcagaatttaccaggtgtccaaaatagttctgatactgttgatgtttctcagtacagctgcgtttttaacctactgataaaagcctgttttgagagcaagaaccttggggtctcatcttctgcagtagacttcatgctttcaaaaaatatagctgttgatttttttctacttagaggattaatcacaggtttgggaagaagttgtttgtggagtaaagctagaacctactacaaaactgctttatcattgggttgctacctgccgctagagggaaatttacatcacaaaattttgccaattcctttttacgtgtctgaggttgagatgctgttggccattgaattattcctcgtttcaaatgccagcgatattcaaagtccaggggctactactcagtctcttcaaataatactgaaaagatgtgaagaccagacagttcagagtaacagtgactatcaagcaggaatggagagacttagcctggctgctcatgtatctgatccaaagctttttcttaagcgtatgacagtgaatgttaatatggaagaagtttacagcttggagcatacatctgctctaaaatggcttcaggagaatatgaaatgggctggaaaggtctggctgtttcagtag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]