GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 05:42:02, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XM_035464866            3108 bp    mRNA    linear   PLN 04-AUG-2020
DEFINITION  Geosmithia morbida PAZ domain (GMORB2_2890), partial mRNA.
ACCESSION   XM_035464866
VERSION     XM_035464866.1
DBLINK      BioProject: PRJNA645152
            BioSample: SAMN13870095
KEYWORDS    RefSeq.
SOURCE      Geosmithia morbida
  ORGANISM  Geosmithia morbida
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Sordariomycetes; Hypocreomycetidae; Hypocreales; Bionectriaceae;
            Geosmithia.
REFERENCE   1  (bases 1 to 3108)
  AUTHORS   Onufrak,A., Murdoch,R.W., Gazis,R., Huff,M., Staton,M.,
            Klingeman,W. and Hadziabdic,D.
  TITLE     Site-based positive gene gene selection in Geosmithia morbida
            across the United States reveals a broad range of putative
            effectors and factors for local host and environmental adapation
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 3108)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-AUG-2020) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3108)
  AUTHORS   Murdoch,R.W., Onufrak,A., Gazis,R., Huff,M., Staton,M.,
            Klingeman,W. and Hadziabdic,D.
  TITLE     Direct Submission
  JOURNAL   Submitted (10-MAR-2020) Center for Environmental Biotechnology,
            University of Tennessee Knoxville, Ctr for Env Biotech, 1416 Circle
            Drive, Knoxville, TN 37996, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_023336202).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..3108
                     /organism="Geosmithia morbida"
                     /mol_type="mRNA"
                     /isolate="1262"
                     /isolation_source="California, USA"
                     /host="Juglans californica"
                     /db_xref="taxon:1094350"
                     /chromosome="Unknown"
                     /country="USA: Southwestern California"
                     /collection_date="Jan-2015"
     gene            <1..>3108
                     /locus_tag="GMORB2_2890"
                     /note="snap_masked-scaffold_15-processed-gene-0.411-mRNA-
                     1"
                     /db_xref="GeneID:55969118"
     CDS             1..3108
                     /locus_tag="GMORB2_2890"
                     /inference="protein motif:EggNOG:03NBJ"
                     /codon_start=1
                     /product="PAZ domain"
                     /protein_id="XP_035319104.1"
                     /db_xref="GeneID:55969118"
                     /translation="
MEVEDVAAAAADAEVEPRFEVVKVVEVADAEEEDTKAAECLLHKTIAGADGVTKYSRPPGGVPVPDRTVTKIEDGLKTSMDMTKLSLKDKERLDMPTRPVYATGGRAVVLWANYVALEAPPKLTLHRYDISVTPEVTGKKLTQVVRLLLEVPDLAALRDDVACDFKATLVSRRELPGPATDVTVRYRGEDEETARESAPEYRVRLRRYPNALTVSDLKAHLTSADLSAVYDDKLPMIQALNIFLNHYAKSSGNLATIGASKVFAMGSQSDTFDLGGCLTAVRGFFASVRAATGRILVNVNVSHGAFYNEGPLLQLFLTFGRQRGLFRLESFIKGLRVRTTHLKERKRSNGQVIPRVKTIFGLAGRNDGHGLAHPPRVKAMGAGAKDVEFWLDAQGQDTSTPAPAPEGADKGGPPGAAAPKKKKKAKGGTSAPAPAPAQGGGGGGRYISVYDFFSNTYGIQIANPEMPVVNVGNRANPTYLPLQVCHVLPGQAAKTKLDPGQTQSMIRFAVRRPAENVLSIVNNGLATAGLSGNTNPLLARFGISATNSLITVPGRVLNGPRVVYKQKKQAHVANGSWNMVPRDSAKLMFDTAGSLSKWSCLYIDMPSMYPSARRFNSQELGQLVSSFHGVLRDTGMAAAPPLPPQRVELSGTDDEQLDTFMQRASSSLQMLLVILPTTPIPLYDRLKQLGDVKYGVHTVCSVGSKMAKPQGQDQYLRNLALKFNLKLGGVNQSVDPGNLGVVAEGKTMVVGIDVTHPSPGSASHAPSIAGMVASIDARLGQWPGVLSIQSRSRQEMVSDLGAMLKSRLALWRARNKSALPENILVYRDGVSEGQYQLVLDTEVPLLREACRQVYPAPDQSRGLPRMAVVVVGKRHHTRFYATQDADADRSGNTKPGTVVDRGVTETRIWDFFLQAHAALQGTARPAHYCVILDEIFRRRAGGAAGATAAGSNVADKLHELTQSMCYVFGRATKAVSICTPAYYADILCERARCYLKDIFDAGSVAAPSSAPGSGMGAQDDDVRIHARLKDSMFYI"
ORIGIN      
atggaggtggaggacgtggcggcggcggcggcggacgcggaggtggagccccgtttcgaggtggtcaaggtggtcgaggtggcggacgcggaggaggaggataccaaggcagcggagtgcctactgcacaagacgattgcgggtgctgatggggttaccaaatattcaagaccacccggaggagttcccgtgccggacaggacggtgaccaagatcgaggatggcctcaagacatcgatggacatgactaagctgagcctcaaggataaggagaggctggacatgccgacgcggccggtgtacgcgaccggcgggcgggccgtggtgctgtgggccaactacgttgctcttgaggcgcctccgaagctgacgctgcaccggtacgacatctcggtgacgcccgaggtgacgggcaagaagctgacgcaggtggtccgtctgctcctggaggtcccggatctggcggcgctgagggacgacgtggcctgcgacttcaaggcgacgctagtgtcccggcgggagctgcccggcccggccacggacgtgacggtccggtaccgcggcgaggacgaggagacggctcgcgagagcgcgcccgagtaccgggtgcggctccggcggtaccccaacgcgctgacggtgtcggacctgaaggcccacctgacgtcggcggacctgtcggccgtgtacgacgacaagctgcccatgatccaggcgctcaacatcttcctaaaccactacgccaagtcgagcggcaacctggccaccatcggcgcctccaaggtcttcgccatgggcagccagtccgacaccttcgacctgggcggctgcctgaccgccgtgaggggcttcttcgccagcgtgcgcgccgccaccggccgcatcctcgtcaacgtcaacgtcagccacggcgccttctacaacgaggggcccctcctccagctcttcctgacattcggtcgccagcggggcctgttcaggctcgagtccttcatcaagggcctgcgcgtcaggactacccacctcaaggagcgcaagaggtccaacggccaggtcataccccgcgtcaagaccatcttcggcctggccggccggaatgacggccacggcctcgcccatccgcccagagtcaaggccatgggcgccggcgccaaggacgtcgagttctggctggacgctcaaggccaggatacctccactcctgcccctgctcctgaaggtgccgataagggaggtccgccgggggcagcggcgccgaagaagaagaagaaggccaagggaggcacatctgcgcctgcgcccgcacccgctcagggtggtggtggtggtggccggtatatttccgtctacgatttcttttccaacacctacggcatacagatcgccaacccagagatgcccgtcgtcaacgttggaaacagggcgaacccgacctatctccccttgcaggtgtgtcatgtgcttccgggccaggcggccaagacgaagctcgatccgggacagacgcagagcatgatccgcttcgctgttcggcgaccggcggagaatgtgttgtcgattgtgaacaacggcctggccacggctggcttgtctggcaacacgaatccactacttgccaggtttggaatctcggcgacgaacagcctgatcacggtgcccggccgggtgctcaacggaccccgcgtcgtgtacaagcagaagaagcaagcgcatgtggccaacggcagctggaacatggtgccgcgcgactcggccaagctcatgttcgacacggcgggcagcctgagcaagtggtcgtgcctgtatattgatatgccgagcatgtacccgagcgcgcggcggttcaactcgcaggagctagggcagctggtcagcagcttccacggcgtgctgcgggacacgggtatggcggcggcgccgccgctgccgccgcagcgcgtggagctcagcggcacggacgacgagcagctggacacctttatgcagcgggcgtcgtcgagcctgcagatgctgctggtgatcctgccgacgacgccgattccgctgtacgaccggctcaagcagctgggcgacgtcaagtacggcgtgcacacggtgtgcagcgtgggcagcaagatggccaagccgcagggccaggaccagtacctgcgcaacctggcgctcaagttcaacctcaagctcggcggcgtcaaccagtcggtcgacccgggcaacctcggcgtcgtggccgagggcaagaccatggtggtgggcatcgacgtgacgcacccgtcgcccgggtcggcgtcgcacgcccccagcatcgcgggcatggtggccagcatcgacgccaggctgggccagtggcccggcgtgctgagcatccagtcgcgcagccgccaggagatggtgtcggacctgggtgccatgctcaagtcgcgcctcgccctctggcgcgccaggaacaagtccgccctgcccgagaacatcctcgtataccgcgacggcgtctcggagggccagtaccagctcgtcctggacacggaggtgcccctcctccgcgaggcctgcaggcaggtctaccccgccccggaccagtcgaggggcctgccgcgcatggccgtcgtcgtcgtcggcaagcgccaccacacgcgcttctacgccacgcaggacgccgacgccgaccgctccgggaacaccaagccgggcaccgtcgtcgacagaggcgtgaccgagacccgcatctgggacttcttcctccaggcccacgccgccctccaaggcacggccaggccggcgcactactgcgtcatcctcgacgagatcttccgccgccgcgccggcggcgcagctggtgctaccgctgccggtagcaacgtcgccgacaagctgcacgagctgacccagagcatgtgctacgtctttggtcgcgccacaaaggccgtcagcatctgcacccccgcttactatgctgacatcctgtgtgagagggcgaggtgctatctcaaggatatctttgatgcgggctcggttgccgcgccgtcatcggctcctggcagtggcatgggtgcgcaggatgacgatgtccgtatccatgcgcgactcaaggatagtatgttttatatatga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]