GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 05:32:26, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XM_035275014            5421 bp    mRNA    linear   PRI 04-JUL-2020
DEFINITION  PREDICTED: Callithrix jacchus testis and ovary specific PAZ domain
            containing 1 (TOPAZ1), mRNA.
ACCESSION   XM_035275014
VERSION     XM_035275014.1
DBLINK      BioProject: PRJNA635392
KEYWORDS    RefSeq.
SOURCE      Callithrix jacchus (white-tufted-ear marmoset)
  ORGANISM  Callithrix jacchus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Platyrrhini; Cebidae; Callitrichinae; Callithrix; Callithrix.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_048397.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Callithrix jacchus Annotation
                                           Release 105
            Annotation Version          :: 105
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5421
                     /organism="Callithrix jacchus"
                     /mol_type="mRNA"
                     /strain="cj1700"
                     /db_xref="taxon:9483"
                     /chromosome="15"
                     /sex="female"
                     /cell_line="cj1700"
                     /tissue_type="skin"
                     /collected_by="Wisconsin Primate Research Center"
     gene            1..5421
                     /gene="TOPAZ1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 mRNAs, 5 ESTs, 2 long SRA reads,
                     3 Proteins, and 99% coverage of the annotated genomic
                     feature by RNAseq alignments, including 3 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:100389725"
     CDS             252..5339
                     /gene="TOPAZ1"
                     /codon_start=1
                     /product="protein TOPAZ1"
                     /protein_id="XP_035130905.1"
                     /db_xref="GeneID:100389725"
                     /translation="
MRRHPPLDPTMAPGPEDNVRNLRKRQARGPGTARGCGPEVGGRRKNRQKRRMVAQASPGKDKVERDRSVAASGAEKATRRRVERPRGQVSPSDRRGIQAAKEAELRLQTERHTKEKRKVTEASSDDPQPEIDLVRKESLTSSESFQTVECLQSLSKEGIVEGIKRRRIRNKKLKSLENPPLKVTENEATQNIKVEFQDELYKNTPKYSCNILSPEVENNSILKLHVCNCFPHSKGCNDENNLPYKPDGGCMHVAENSSKLKKENLRSLAEKSDTNSIPWLLQTKESVMGVNKLLLEESDLCQSKTNDLLSCLQREKNKYSIEESSVGRKSRKRIKSEKAVTESETVTEMNFYEYNKSELMLQENKMIADGKEAETKSPLNVLRKVSHNTVSLMDHLLSLPEMVGKETSPEHHVNAVCQKTIEPLLKEETENASEPLGYESMAQTEDFKSMKSSIGKSPNEYHIEKRSSQEELRRESEELKLSCQRTIPMTGKRTWPYYSCARISAWCWKKASLPESSYFLPGSQESCRQDDVLKHQTNQTHLTDSKLLLQSSLTETNIESSSKEKLDSNSNCLSSVSAIEHTLMVMKEPIIEDDKKIKSEELSKSGSEVVSNTTEDTQLISETQILTGNKKKDRGNLTKLNLIATSKDGQEANNSTGRTIHRKSCVAKQTFVAPDLVKILNTGRLTNFKIPLLKNKTEKRKEINAKSSEREAYSPLELLDNLSGAEVRQNRSKESVSMTTSGPQTLSIQNSVTPAQASSDSFYNKNSCSIYPRFTKQDNNNKPSNHISEQGNIVSNKEVASLTVENNTFSYDPGYVEKNSFFSCNEQETFQPVSSEVSGRKITKNFSEIKVGSPDILKAYEDDVLLIDVIQDDPDLFGVSNEGELSCTSGVSRISQEPSVAGEDQSADFKYMETPVKKEPSDNLRELSVLDTGSIKSEACASNSAASEIRHDSKDVNTSLGKVANKASENETLEDFSEQIKGSNLDKKHRFTDKVIIKEEKEKIYEVCKSKDSRNADIMVDECQFAAPVPKPLCLLVPPLNLSGHQEETVLNTWTNDFRFLGKHSVLKLQNPATCEIFKREKNVGVLQKSLGLMLPYKYCRFHFNTLRGCERPLCKFVHVPEQGDEKVCMDVFKKYININELCLLQRAVNIFMEYYRKFPPGIHFDLQVLNDLLNSLLKHCLLKEVFQIVNLSIMVKIQPSLKILLNIFEHVATMKLRNAVPALTDIFCKLIEAGMVLDPEHFNYIVKLLYQVQASKQEITAVLEMRSRLQTRLFKKNWKCDLDSALNKLEHCKEKGDWTRLGKLYLNVKMGCEKLADFETFCACIAKTLTKHYEKEGPDVPFCEFAETVSKDPQNSKVDESVLGRIGISALFFYHKLLQWSKGRKVLDKLYELKIHFTSLKGLIGPEMLASRCQIVNVAAEIFLKSGSLNGAIWVMRESEWIINTPLWPCDRLDVLNRHNLLCTIAHDILAKSLFRQAFEVLQNLPGFQNSQETVEVSQYSILFNKLLDSCIESNSLGTSSSVAEFMISKSVPIDFSFLRRLITSLGRSCLWLKARAHYKSALSLGCYPQLEGNLYRKLLLIPSYLSEIEMLLAMEIFMVSNASSIQSPGTSTQILQIVLKRCENNQSQRNDDYQAAVERLIMAARISDPKLFIKHMTVNINKEQVYSLEHCSVLKWLKENMKWAGKVWLFSNH"
ORIGIN      
agacgctagcacggaactcgccgctcaccagcccgttggatcccgaagcgccagtccggggccccagccactcggcccacttccgcttacgcgccccacttccgcttccggccctaggctgtggtgacgagcagtgtggggtgggtcagaaggtagtaggtgctggaggcggaggcgggtgcagtctttgcgcggcggtgggttcctgcgagctggtgcggaggagccctggcgggccggccctggggcacatgcgacgacatccacccctggatcccacgatggccccgggtcctgaagacaatgttagaaacctgcggaaacggcaggcgcgagggccaggcacagcgagaggctgcggcccagaggtcggagggcgcaggaaaaataggcaaaagaggagaatggtggcccaggccagccctgggaaagacaaggtggaaagagacaggtcggttgcggcatcaggggctgaaaaggccacaaggcgtcgagtggagaggcccaggggccaggtgagcccgtcagaccggcgaggaatacaagcagcaaaggaggctgaactccgcttgcaaacggaaagacacaccaaggaaaaaagaaaagttactgaagcctcaagtgatgatcctcagccagagattgacctggtaagaaaggaatcattaaccagttcggaatctttccaaacagtggaatgcttgcagtctttgagtaaggaaggtatcgtggaaggcattaaaagaagaagaattcgaaataaaaaacttaaaagcttagaaaacccacctctcaaagtaacagaaaatgaggctacacaaaatattaaggttgaattccaagatgaactgtacaagaatactccaaaatattcttgtaacatcttgtcacctgaagtagaaaataattccattttgaaattacatgtttgcaattgtttcccccattccaagggttgtaatgatgaaaacaacctgccatataagcctgatggtggatgtatgcatgtagcagaaaattcctcaaagttaaagaaagaaaaccttaggagtcttgcagagaagagtgacacaaatagtattccttggcttttacaaaccaaagaaagtgtaatgggagtaaataagttactactagaagagagtgatttatgccaaagtaaaaccaatgacttgctttcctgccttcaacgtgaaaaaaataaatactcaatagaggagagcagtgttgggcgaaaatccaggaaaagaataaagtctgaaaaagcagttactgagtctgaaacagttactgagatgaacttttatgagtataacaagtctgagttgatgttgcaagaaaataaaatgattgctgatggtaaagaagcagagactaaaagtcctttaaatgttctgagaaaagtaagccataatacagtctctctgatggatcatttattaagtctcccagaaatggtaggaaaagaaacaagtcccgaacatcatgtaaatgctgtgtgtcagaaaaccattgagccacttttgaaagaagaaacagagaatgcttcagagcccttaggatatgaaagcatggcacagacagaggattttaaatcaatgaaaagctccatagggaaatcacctaatgagtaccatattgaaaagagatcttcacaggaagagttgagaagggaatctgaagaactgaagttaagctgtcagagaacaatacctatgactggtaaaagaacttggccttattattcatgtgctcgaatatctgcctggtgttggaaaaaggcttccttgccagaatcaagttactttcttcctgggtctcaggaaagttgtaggcaagatgatgttcttaaacaccaaacaaaccagacccatttaactgactccaaattattattacaaagttccttaacagaaacaaacattgaatcttcaagtaaagaaaaactagattctaattcgaattgtttgtcttcagtttctgcaatagaacatactttaatggttatgaaggaacctataatcgaggatgataaaaagataaaatcagaggaactgagcaaaagtgggtcagaggtggtttctaacactactgaagatactcagttaatcagtgagactcaaatcttaacaggaaataaaaaaaaagatagaggaaatttaacaaaactaaatttgatagcgacttccaaagatggtcaggaagcaaataactctacaggcagaactattcatcgaaaatcatgcgttgctaaacaaacatttgtagctccagacttggttaaaatattgaacacaggaaggctaactaattttaaaattcctttacttaagaataaaacagaaaaaagaaaagaaataaatgccaagtcatcagagagagaagcttacagtcctctagaacttctggacaatttatctggagcagaggtaagacagaataggagtaaagaaagtgtctccatgacaacatcaggacctcaaactttgagcatacaaaatagcgtcactccagcgcaagctagttctgattcattctacaataagaattcctgtagtatttatccacggtttacaaagcaagataacaataacaaaccatctaatcacatctctgaacaaggcaatattgtgtctaataaagaagttgcttctctcacagttgaaaataatactttttcttatgatcccgggtatgtagagaaaaattctttcttcagctgtaatgagcaagaaacattccagccagtttccagtgaagttagtggtagaaaaataactaagaatttttcagaaatcaaagtagggtctccagatattcttaaagcatatgaagatgatgtcctcctaattgatgtaattcaagacgacccagacctctttggagtctccaatgaaggagagctctcatgtacttcaggggtctccaggataagccaggagcccagtgttgctggagaggaccaatcagcagacttcaagtacatggaaactccagtaaaaaaagaaccaagtgacaacttgagagaactttctgtactggacactggatcgataaagtcagaggcctgtgcttccaactcagcagcaagtgaaataagacatgattccaaagatgtgaacacttccttaggaaaagttgctaataaggcctctgaaaatgaaacactggaagacttcagtgaacaaataaaaggttcaaacttggataaaaagcatagatttacagacaaagtgattatcaaagaagaaaaagaaaagatttatgaagtgtgcaaaagcaaagattctaggaatgcagacattatggttgatgaatgtcagtttgcagcaccagtcccgaaacctctgtgcttattagtacctcctttgaatctaagtggtcatcaagaagaaacagtactgaatacctggacgaatgatttcagatttttgggaaaacattctgtcctaaagctgcagaatcctgcaacttgtgaaatatttaagagggaaaaaaatgtaggggtgctccagaagtccctggggttgatgttaccctataaatattgcagatttcattttaatacgttacgtggctgtgagcgtccactgtgcaagtttgttcatgtgcctgaacaaggggatgaaaaggtttgcatggatgtgtttaagaaatatataaatatcaatgaactgtgtttgctacagcgtgcagtaaacatatttatggaatactacagaaagtttcccccaggtatacactttgatttacaagtgctaaatgaccttctaaattctttactcaaacattgtttattgaaagaagtatttcaaatagtgaacctcagcataatggttaaaatacagccttctctgaaaatattactgaacatatttgagcatgtggcaactatgaaattaaggaatgctgtacctgctttaactgatatattttgcaagcttattgaagctgggatggtgcttgatccagagcactttaactatattgttaagctcttataccaagtacaagcttccaaacaagaaataactgcagttctggaaatgagatccaggttacagacgaggctatttaaaaagaactggaagtgtgatttagattcagccttgaataaattagagcattgtaaagaaaaaggtgactggaccagattgggaaaattataccttaatgtaaaaatgggctgtgaaaaacttgcagattttgagacattttgtgcttgcattgctaaaacactcacaaaacactatgaaaaagaaggaccagatgttcccttttgtgaatttgctgaaacagttagcaaagatccacaaaacagtaaagtagatgaaagtgtgctgggaagaatcggaatcagtgctttgttcttctatcacaagctgttgcagtggtccaagggaaggaaggtgttagataaactatatgaattaaaaatacactttacaagcttaaaaggacttatagggcctgagatgttagcatcaagatgtcagattgtgaatgttgcagcagaaatttttctaaaaagtggaagcctaaatggtgccatttgggtaatgagggagtcagaatggataatcaatacgcctctgtggccttgtgataggctggatgtgcttaatcgacataatttgctctgtacaattgcacatgacatcttagccaagagcctttttagacaggcatttgaagttttgcagaatctaccaggttttcagaattctcaagaaactgtggaagtctcacaatatagcattctttttaataagcttctagattcctgtatagaaagcaacagtcttggtacatcatcctctgtggcagaattcatgatttcaaagagcgtacctattgatttttcctttcttagaagattaattacttctttaggaaggagttgtttatggctcaaagccagagcccactacaaaagtgctctttccttgggttgctacccacaactggaaggaaatttataccgaaaacttcttctaattccatcttatttatctgagattgaaatgcttttagcaatggaaatcttcatggtatctaatgctagtagtattcagagtcctggaacttctacacagatactacagatagtattgaaaaggtgtgaaaacaaccagtctcagaggaatgatgattatcaagccgcagtagaaaggttaattatggctgctcgtatatcggatccaaagcttttcatcaaacacatgactgtcaatattaataaggaacaggtttatagtttggaacattgttctgtcctgaaatggttaaaagagaatatgaagtgggctggaaaggtttggcttttcagtaaccattagttaataaagtctgctcttttttacgttcaagtaatcattgttgaaaataaaaggcaataaaaataaagacagtttcaccata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]