GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 06:27:50, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XM_035182039            4078 bp    mRNA    linear   VRT 29-JUN-2020
DEFINITION  PREDICTED: Hippoglossus stenolepis testis and ovary specific PAZ
            domain containing 1 (topaz1), mRNA.
ACCESSION   XM_035182039
VERSION     XM_035182039.1
DBLINK      BioProject: PRJNA642014
KEYWORDS    RefSeq.
SOURCE      Hippoglossus stenolepis (Pacific halibut)
  ORGANISM  Hippoglossus stenolepis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Carangaria; Pleuronectiformes; Pleuronectoidei;
            Pleuronectidae; Hippoglossus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_048943.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Hippoglossus stenolepis Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4078
                     /organism="Hippoglossus stenolepis"
                     /mol_type="mRNA"
                     /isolate="PH-IPHC-18"
                     /db_xref="taxon:195615"
                     /chromosome="17"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /country="USA: Seward, Alaska"
                     /collection_date="23-Oct-2018"
                     /collected_by="Josep V. Planas"
     gene            1..4078
                     /gene="topaz1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 2 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:118124365"
     CDS             130..3921
                     /gene="topaz1"
                     /codon_start=1
                     /product="uncharacterized protein topaz1"
                     /protein_id="XP_035037930.1"
                     /db_xref="GeneID:118124365"
                     /translation="
MFPSSSRVKLNRVALKDVAGLQPHFPRRRRVSRSPGKVPAESEKPEASEGTCAKDTAAVHGGDEPAESCSTRRGDPGNASGGTAKETRRRKVMESRRESDGEEFEPEGPDTRDNNRNTRPSPTGSQGCSRRTVSASHCGLCGDCKYMSPHKKTLVKKEQKSCSPGPELSADEFKINKGNPVTDASKETVIWVDQYAKVTLCDIAQKCDPCSHNCGYVLPDVLKNKVVHCFKHDVTDVQEDPGPRYDLIGAEISRKKRKKLGYSFTKGSMPSTPDSENISCNNTARTLFIDEEKTCSGVSGNSQSGQELTFGSCSTHTSTTKENCVHEKHWVQIDKPRETDAAQMSSELFCPTNKVDADEPDSFTCQRVRVYNRKIKFSCARTYMSWPFSNTSRTLTANTGTAARNNSDSPINQNQSGLLSSQTNDVLPNAPTEPSSDTTHKVSHQNEEREDVGCITAKRNGKRHSHMSSYSSESNNMEFQPHFTDAEESFASLLLDSAPPPTPSQRERAPGTYTALGLSMPANGPETNSSTSTPSPSVLGLSDWETTTTASPTSFQFTCSGLSSPLATPSSGPPSLFLLEKVKGVESAEAHSARTSPLSSAKRVNSAVKKALFHCEETQMTSCCSSPTSPSFSLHNCASCPSCESFLLLPQDRQEGDKEILTDRSPSKLEHYYNQSPVNQNHPVAFGKGSSSSQNIAMEEWGEIYSNEFLLPPLLSPVTSPRGHLYTSPLPQRQCCSDEEEEMNHDTSKHIKLHGHHMPQIGEGDHQNGRDEHEGHVNEEMEGVSSKCNTVNDDFRDGSQDNTDYEDDVEQGDRSLSEPCSSPSSDDESLPSEREERLSPSEMVGSKRHKTEAEAAGGTDGSLLDEFTAYERDILLINVIHDPELFENLPEESLQKLGPPRVSDAPKTRPTGAVKTLSQRWTPVIVDSHSDCPEITEESNSRPWRPQCNGNLSTTMGQFDANNNVNWSQEWSQPLQTVNPPHNIPAHMSLRNGPLITNPANMTEFKRKKSTAYCRQYFSESLSCGFKMCRFHHVPLDGDEKFCVETVMRFINNPTCLQKAGAVFTGYYQKNPPGAFFSMPVFLSLLWCLLKACMVSDILSVLSVGLAHKIAPGHEFLLALFDMVRGKGLMGYLPQLMQLTFKMASRGLVLSLDCLESVKNTPEFQQATRSNSPVSVTANLNVPFPEYLNLAPCIVEIELCTKQQDWRRMGKVFRSICQSSHHPNQVEQISGRIAKALLSESKDKMSLPFATFAETVCSGEGDA"
ORIGIN      
atgagcgctgtgtcagggagctcggttaaaggggatcggttgtagtgagcttcacttgaagttttatagcagcgacgcagacggcgctttatttactaagtttccacagccacagttttaattgtcagcatgttcccgtcctccagcagagtgaaactcaaccgagtcgcgttaaaagacgttgccggcctccagccgcactttccgcggcggagacgagtctcaaggtcgccgggtaaagttccagccgagtccgaaaaaccagaagcttctgagggaacttgtgcgaaagacaccgccgccgtccacggaggcgacgaacccgcggagagctgctcaacgcggcgaggggacccgggcaacgcgagtggaggaaccgcgaaagagacgagaagaagaaaagtgatggagtcacgcagagagagtgatggagaagagttcgaaccagagggacccgacactagagacaataacaggaatacacgtccaagccccactggttcacaggggtgttcgagaagaactgtctcagcctcccactgtggtctctgtggggactgtaaatacatgtcccctcacaagaagacactggttaagaaggagcagaaaagctgtagcccaggaccagagctgtctgcagatgagttcaagattaataaaggaaacccagtcactgatgcctctaaggagactgtcatatgggtggaccagtacgcaaaggtaacactttgtgacatagcccaaaaatgtgatccatgcagtcacaattgtggctatgtgttaccggatgttctcaagaacaaggttgtgcattgcttcaaacatgacgtgacagatgttcaggaggaccctggaccacgttatgacctcattggagcagagatttccagaaagaaaagaaaaaagcttgggtatagctttacaaaaggaagcatgccttccacccctgactcagaaaacattagttgcaataacacagcaagaactctctttatagacgaagagaaaacatgttctggggtgtctggtaacagtcagtcaggtcaagaactcacatttgggagctgcagcactcacacttcaactacgaaagaaaactgcgtccatgaaaaacattgggttcagatagacaaacccagagaaactgacgcagcacaaatgtcatcagaactgttctgtccgactaacaaggtggatgcagatgaaccagattcattcacctgccagagagtgagggtctataacagaaaaattaaattttcttgtgcacggacatacatgtcttggcccttctctaacacaagccgtacccttacagcaaatactggcactgcagctagaaacaacagtgactctccaatcaatcaaaatcagtcaggtttgctgagcagccaaactaatgatgtgctcccaaatgcacctacagagccctcttcagacacaacccacaaggtttcccatcaaaatgaagaaagagaggatgtagggtgcattacagccaagagaaatgggaaaagacacagtcatatgtcttcatactcttcagagagcaataacatggagtttcaacctcactttacggacgctgaagaatcttttgccagtctgctcttagattcggccccacctcccaccccaagtcagcgtgagagagcgcctggcacttacacagctttaggcttaagcatgccagctaatggaccagaaaccaacagctccacgtctaccccatccccctcagtgttgggcctgagtgactgggaaacaaccactactgcgtctcccacatcatttcagttcacatgcagtggtctgagcagccccttggccacgccgtcctctggcccaccttcattgttcttactggagaaagtcaaaggtgttgagtcggcagaagctcattctgcacgcacatcaccgttgtcctcagccaaacgagtgaacagcgctgtaaaaaaagcattgttccactgcgaagaaactcaaatgacttcatgttgttcttcacctacatctccatccttttctttgcacaactgtgcctcctgtccgtcatgtgaatccttcctcctcctacctcaagataggcaagagggtgataaagagattctcacagacaggagcccatcaaaactggagcactattataaccaaagccctgtgaaccagaaccaccctgttgcttttggaaaaggcagctcatcatcacaaaacattgccatggaagagtggggagaaatttactcaaacgaattcctgcttccaccacttctctctcctgtcacttcacctcgagggcacttgtatacaagccccctgccccagaggcaatgttgttcagatgaagaggaagagatgaaccatgacaccagtaaacacataaaactacacggacatcacatgccacagattggtgaaggtgatcatcaaaacggcagggacgaacatgaaggacatgtaaatgaagaaatggagggagtctcatcaaaatgtaatactgtgaatgacgatttcagagatggaagccaggataacactgattacgaagatgatgtggaacagggtgacagatctttgtcagaaccctgctcttctcccagcagcgacgatgaatcccttccgtctgaaagagaagaaagattaagtccatctgaaatggtgggcagtaagaggcataaaactgaagcagaagcagctggtggtactgacggcagccttcttgatgagttcaccgcttatgaacgtgatatcttgcttatcaatgtgatccacgacccagagctgtttgaaaatctacctgaggaaagtctgcaaaagctgggccctccaagagtcagtgacgcccctaaaaccagacctactggagcagtgaaaactctatcacagagatggacaccagttattgtagattctcacagcgactgtcctgaaatcacagaggaaagtaacagcagaccctggagacctcaatgtaacggcaacctttccacaaccatgggtcagtttgatgccaacaataatgtaaactggagccaggaatggagccagcccttgcagacagtgaaccccccacataacatccctgcacatatgtccctaagaaatgggccattgatcacaaacccggcaaacatgacagaatttaagcgcaagaaatctactgcttactgcagacagtacttcagtgagtctctgtcctgtggattcaagatgtgtcgattccatcatgtgcctttggacggggatgagaagttctgtgttgaaactgtgatgcggttcatcaacaatccaacgtgtctccagaaagcaggagctgtatttacaggctactaccagaaaaacccaccaggagcgttcttctccatgccagtgtttctgtcactcctctggtgtctgctcaaagcctgcatggtgtctgatatcctctcagtccttagtgtcggcttggctcataagatagcgcctggccatgagttccttctggccctgtttgacatggtgagagggaagggtctcatgggctatctacctcaactcatgcagctcacattcaagatggccagtagaggtctagtgctaagtttggattgccttgaaagtgtaaaaaatactcctgagttccagcaagcgacccgttcgaactctcctgtttcagtgactgccaacctcaatgttccctttccagagtacctgaatctggccccatgcattgtggaaatagagctttgtacgaagcagcaggactggaggcggatgggaaaggtgttcaggtccatctgccaatccagccatcatcccaaccaagtggagcaaatcagtggccgcatcgccaaagctctcctgtcagagagcaaagacaagatgtcactgcccttcgctacctttgctgagacagtgtgttcgggtgaaggtgacgcctgatcaagaattttttaggcagaattggagtctcgctcatgttaagatatcacaaaacacatcaatgggccaagggtcggcgggtggtggaggtgctgtccatgtcaaaagtcagctactcaatgctgaagggtttgtttgggaatgaagacggagcttc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]