GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 04:39:21, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XM_034704449            5493 bp    mRNA    linear   VRT 23-MAY-2020
DEFINITION  PREDICTED: Notolabrus celidotus testis and ovary specific PAZ
            domain containing 1 (topaz1), transcript variant X9, mRNA.
ACCESSION   XM_034704449
VERSION     XM_034704449.1
DBLINK      BioProject: PRJNA634114
KEYWORDS    RefSeq.
SOURCE      Notolabrus celidotus (New Zealand spotty)
  ORGANISM  Notolabrus celidotus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Labriformes; Labridae; Notolabrus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_048287.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Notolabrus celidotus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5493
                     /organism="Notolabrus celidotus"
                     /mol_type="mRNA"
                     /isolate="fNotCel1"
                     /db_xref="taxon:1203425"
                     /chromosome="16"
                     /sex="male"
                     /tissue_type="liver"
                     /dev_stage="adult"
                     /country="New Zealand: Tauranga"
                     /lat_lon="37.39219 S 176.09222 E"
                     /collection_date="24-May-2018"
                     /collected_by="Simon Muncaster, Erica Todd, Neil Gemmell"
     gene            1..5493
                     /gene="topaz1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 long SRA read, and 100% coverage
                     of the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:117827731"
     CDS             166..4989
                     /gene="topaz1"
                     /codon_start=1
                     /product="uncharacterized protein topaz1 isoform X9"
                     /protein_id="XP_034560340.1"
                     /db_xref="GeneID:117827731"
                     /translation="
MLPSCSRVKLNRVALKHVIGPRLVPRRRRDPGSAVSKKEEETRTETSTAHSSDEPVQKILTDQMCPTNVTDISEAVPEENCLDTERSTHSNPTGPTDSEGSLRRAVKASHCGLCGDCKYISPQRKTLGKPRQKSSGPGPGQPIVDFKLEERKTAPEISQKSVMWKDPWPKEMRPGFGPGCSDCSEQENKKDAHANTTEKNVCQSKSLTPHDSNITECTDLKSFTNHTPCCFLESWTSEGSATGSASLLLDECTTKRECRTVMKDRNTEQDPGPGYPLTRVGLCRDKRKKLTDCFEDGILPPTPDLDSTNNSKKTIENDKEKTHFWVSSNGQPCSENVQSVGSSNTFSPDVSGNYVHKKPSGRKGSPSKTNAAQMSPELSCQNNEVDSDEPESFTCQRVRVFKRTVLFSCARTYMSWPFTKCSWTLTANAGTSAQSAEHVDDRKEEEDGKCILAERNGTTHDDMSLYSSLGRDMEFAPHLVEAEELQNSLSNPSQYGQNAASPSSSPVNDPKTDSYLSTRSPKALCPSGWKTAPRFSPMSSPFTHSGSSRISYTTSSPTPSVSLLTTVKSVELAEDLSANTLPVLLSPSQVVQPVPRKSLMCDEESQMTRCHNSESYTSFGSFHPITQEEQESDEELLADRFPPKLEPYYKTSPVNHDLVFTENNEDMFSNDFVLLPVLSPVISPTPHFPTTALPQSPVCLDEEEEEINEEPNQHKSLPGCFIPHIVYGNNGKTEDDLVHRSKHFERISRNLISQASLSEQSFPSSDEDLETDDGEHFMQVDKKSEEVSSGSKITPGLDAQAKSCSSSCSDKDDYGAFSDKEQPCLSREELIGPCKRAGPDRAQVKAKAAGDTHQSVWDEFTAFEQDILLVDVIQDDPELFENMPQKSLLKLGPTRISEVLKTRKGQASVDVKKRSSLVFVSISYPQSKTNPDIKDESNSRSWRPQSVRNPATRERITWTAKEKPIRILRQPDANNNHVNGGLERSQPIQTVISLHNHTLALKTPKNGSWNTNLTDAAELRRQQSNAYCRQYFSESLSCGFNMCWFLHVPGDGDEKFCIETVTRFTKNPVCLQKAGAVFTGYYQNNPPGVYFSMPVLLSLLWALLKAGMLSDVFSVLSVSSAHKIVPGHEFVLALFNFVREKSLLSLVPELMQLTFKMASAGLVLSSDCLDCVKNTPEFQKTNSNVSVSDNQNRMPTSGPFPENLKLVHAIVEIELCTKQKDWRQMGEVFRSICQSSQRPNQVERISGRIAIALLSESKDKLSLPFAAFAETVSQNEEEESLSRSFLGRIGVSLMLRYHKTHQWAKGRKVVEVLSSSKVNYSLLKGLFGNEDGASRCCLVTVATELFLLSGSVEGALNTLRENKWFVSSCSWPCEPADLESRIRVLARLAEKSSHRDSFDILSNLPGLKETSNSVDISRYASQFNFHLQVCLDRQMLPVASDTVDFMLSKNLAVDPTMLHMLLDKLGKQNLWHHAREIFRHALSAEYYPGVSAPPGFFSLIIPCRLGEVELALTLEMYITVNATVLLHQPENTSSCLSITLKRTQSCESEYLSAGSRLLSASCIPQPKLIIHYKYVNASQEQVFTLDIPSARFWLRHNHRWANEVWTH"
ORIGIN      
aactaattcgagcagcagggacatatgcagtactaatggcagcgtcgaggccttcacgggtctaatactgaaagttcagctttatcccaaaagcacgttttatcgtaagcagaataagaaatcactatttgttttatttactgtaacctctctttatcagccagcatgttaccatcttgtagcagagtgaaactgaaccgtgtagcgttaaaacacgttattggtccaagactggtaccgcgtcggagacgagatccgggatcagctgtctcgaaaaaagaagaggaaacccgaactgagacttctacggcccatagcagcgatgagcccgtccaaaagattttaacagaccaaatgtgcccaacaaatgtgaccgacatctctgaagcagtgccggaggagaactgtctagacactgaaagaagtacgcactcaaatcccactggacctacggactcagaggggtctttgaggagagctgtcaaagcctcccactgtggtctctgtggggactgtaaatacatttcccctcagcggaagacactgggtaagccaaggcaaaaaagcagtggcccagggccagggcagcctatagttgattttaagcttgaggaaagaaaaacagccccagagatctctcagaagagtgtcatgtggaaagacccttggccgaaggagatgagacctggatttggccctggttgttccgactgcagtgaacaagaaaacaagaaagatgcccacgctaatactacagagaagaatgtctgtcagtcaaagagtctgaccccacatgacagcaacattactgagtgcacagacttaaagtcatttaccaatcataccccatgttgtttccttgagagttggacaagtgaaggctctgcaaccggttctgcttctctcttattagatgaatgtactaccaaaagggagtgcaggactgtcatgaaggacagaaatactgagcaggatcccgggccaggctatcccctcacaagagttgggctttgcagggacaagagaaaaaagctgacagattgttttgaagatgggattttgcctcctactccagacctggacagcaccaacaactccaaaaagacaattgaaaatgacaaagagaaaacacacttttgggtgtcttctaatggccagccttgttcagagaatgtccaaagtgttggcagcagcaacacctttagccctgatgtgtcaggaaactatgttcataagaaacctagtgggaggaaaggcagtccctcaaaaaccaatgcagcgcaaatgtcccctgagctgtcctgtcagaacaatgaagtggattcagatgaaccagagtcattcacctgccaaagagtgagggtctttaaaagaacagtccttttttcctgtgcacgcacatacatgtcctggcccttcactaagtgtagctggaccctgacagccaatgcagggacatcagctcagtctgcagagcatgttgatgacagaaaggaagaagaagatggaaaatgcatcttagcagagagaaatgggacaacacacgatgatatgtctttatactcttctttaggaagagacatggagtttgctcctcatttagtggaggcagaagaattacagaattccctttccaaccccagtcagtatggacagaacgcagcctcgccttcatcctcaccagttaatgatcccaaaactgacagctacctatctacccgttcccccaaagcactttgcccgagtggctggaaaactgctcccagattttcccccatgtcatctccatttacacatagtggttcaagcagaatctcgtacacaacatcctccccgacaccttcagtctccttactgaccacagtcaaaagtgtcgagttggctgaggatctatcagccaacacattgccagtgctgctttcaccctcacaagtggtccaacctgtaccaagaaagtcactgatgtgcgatgaggaatcccaaatgactagatgtcacaattctgagtcctacacttcattcggatcgttccaccccatcactcaagaggaacaagagagcgatgaagaacttcttgcagaccggtttcctcctaaactggagccatattacaaaacgagccccgttaaccatgatctcgtcttcacagaaaacaatgaggacatgttctcaaatgactttgtgcttctaccagtgctatctcctgtcatttcaccaacacctcactttccaaccacggcccttcctcaaagtccagtctgtttagatgaagaagaggaggaaataaatgaagaacccaaccaacacaaatcattacctggatgtttcattccacatattgtttatggcaataatggaaagactgaggatgatcttgtacatcgtagcaaacattttgaaagaatctcgaggaatttaatatctcaggcttctctgagtgaacagtcttttccaagcagtgatgaagatctagaaactgatgatggagagcattttatgcaggttgacaaaaaatctgaagaagtttcctcaggctctaaaataacccctggcttggatgcgcaggcaaaatcctgctcctcttcctgcagtgacaaagatgattatggagccttcagtgacaaggaacagccatgtttgtccagagaggagctgataggcccatgtaaaagagcaggccctgatagggctcaagttaaagcaaaggcagctggtgacactcatcagagtgtttgggatgagttcacagcatttgaacaggatatcctgcttgtggatgtgattcaggacgacccagagctgtttgaaaacatgccccagaaaagtttgctgaaactaggtcctaccaggatttctgaggtcctcaaaaccaggaaaggccaggcatcagttgatgtaaaaaaaaggtcaagtcttgtatttgttagtatctcatatccacagtcaaagacaaatcctgatatcaaagatgagagcaacagcaggtcatggagacctcagagtgtcagaaaccctgccacaagggaaaggatcacatggactgccaaagaaaagccaatccggatcttgcgtcagcctgatgccaacaacaatcatgtaaacggaggcctggaaaggagccagccaatccaaacagtgatctctctgcataatcacacccttgcactgaagactccaaaaaatgggtcatggaacacaaacttgacagacgcagcagagttaaggcgccaacagtcaaatgcttactgcaggcagtacttcagtgagtcgctgtcctgtgggttcaacatgtgctggttcctgcacgtgcctggggatggggacgagaagttttgcatagaaactgtgacacggttcaccaagaacccagtgtgccttcaaaaagcaggggctgtctttacaggctactaccaaaacaacccaccaggagtgtatttttccatgccggttctactatcgctcctctgggctctcctcaaagctggcatgctgtccgatgtgttctcggtcctcagtgtcagctcggcccataagatagtgcctggccatgagtttgtcttagctctcttcaactttgtaagagaaaagagtctcctgagtttggtgcctgaactcatgcagctcacattcaagatggctagtgcaggcctggtgttgagttcggactgcttggattgtgtgaaaaacactcctgagttccagaagacaaactcaaatgtttctgtatccgacaaccaaaacaggatgcccactagtggaccctttccagagaacctgaaattggttcatgccattgtggagatagagctctgtaccaagcagaaggactggaggcagatgggggaggttttcaggtcgatctgccaatccagccagcgccccaaccaagtggagcgaatcagcggtcgcattgccatagcactgctgtcagagagcaaagacaagctgtcactgccctttgctgcatttgctgagacagtttctcagaatgaagaggaggagagcctgagcaggagttttttaggcagaattggtgtctctctcatgttgagatatcacaaaacgcatcaatgggcaaagggtcgaaaggtggtggaagtactgtccagctccaaagtcaactactcattactgaaggggttgtttgggaatgaggatggagcatctcgctgctgcctggtcactgtggctactgagttattcctgctgagtggcagtgtggagggagctctaaacacactccgagaaaacaaatggtttgtgagttcgtgctcgtggccgtgtgagcctgctgatctggagagcaggattcgtgtgttggcacgtctggctgaaaaatcttctcacagagactcgtttgatatcctcagcaatctccctggactcaaggagacgagcaactcggtggatatctcgaggtacgcctctcagtttaactttcacctccaagtgtgcttggacagacagatgcttcctgttgcttcagacacagtggacttcatgctgtctaaaaacctggcagttgatcccactatgctgcacatgcttttggacaaactgggcaagcagaacctctggcaccatgcgcgggaaatcttcagacatgctctaagtgcggaatactaccctggtgtttctgctcctcctggtttcttctcactgatcatcccctgtcggctgggggaggtggagctggctctcaccttagagatgtacatcactgtcaacgcaactgttctcctccaccaaccagagaacacatcctcctgtctcagcattactttgaagaggactcaaagctgtgaaagcgagtacctttccgctggcagtcgcctcttgtcagcatcttgtatcccccagcctaaactaattattcactacaaatatgtgaacgcctcacaggagcaagtcttcaccctggacatcccctcagctcgattctggctccgccacaatcataggtgggccaatgaggtgtggactcattgaaccaggttggcgctgtagtccctctctttgctttctgtttggagggccaataaaaacaaaacaaacacatgaaatcagttaaccattgtttgtgaatttctgttggctgcatgtttgtaatcccagagactgacactagaactttacaccatggtaacatatttttgttcttgtttgttttaatatgtttaagggttgtttttatcacttccttgtttcctggagagttctttaagtgtattcgtctttggtttcatcactcagtatttttgtgatttattgtttgaataagtaatcattctattggggaacagaaccctacaattttgtaagatttgaatatttggttataaataaatgtaaataacatctgagtgaacataggtgagtatttgaactgtgttaagtctttgcaattgttatgttactgtattgttccagagttgtcactttgatttcctttgtatgaatttttataataaaaaagttgttctgctccagaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]