GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 06:13:48, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XM_034484261            5186 bp    mRNA    linear   ROD 16-MAY-2020
DEFINITION  PREDICTED: Arvicanthis niloticus testis and ovary specific PAZ
            domain containing 1 (Topaz1), mRNA.
ACCESSION   XM_034484261
VERSION     XM_034484261.1
DBLINK      BioProject: PRJNA632612
KEYWORDS    RefSeq.
SOURCE      Arvicanthis niloticus (African grass rat)
  ORGANISM  Arvicanthis niloticus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Arvicanthis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_047678.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Arvicanthis niloticus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5186
                     /organism="Arvicanthis niloticus"
                     /mol_type="mRNA"
                     /isolate="mArvNil1"
                     /specimen_voucher="T564M"
                     /db_xref="taxon:61156"
                     /chromosome="21"
                     /sex="male"
                     /tissue_type="Spleen (genome), brain & testis
                     (transcriptome)"
                     /dev_stage="adult"
                     /country="USA: Santa Barbara"
                     /lat_lon="34.41938 N 119.69905 W"
                     /collection_date="06-Mar-2019"
                     /collected_by="Huishi Toh"
     gene            1..5186
                     /gene="Topaz1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 mRNAs, 3 Proteins, and 8%
                     coverage of the annotated genomic feature by RNAseq
                     alignments"
                     /db_xref="GeneID:117693538"
     CDS             147..5114
                     /gene="Topaz1"
                     /codon_start=1
                     /product="protein TOPAZ1"
                     /protein_id="XP_034340152.1"
                     /db_xref="GeneID:117693538"
                     /translation="
MRPPRTPPGPTTAPGRKGSTRGLRKRGLPLTLTPEPGERGGCRLEARGREEESRQKRRMAQASGREGTEGDKLAKENGKLTEAPSDDPQPGTDLVRKASITSSESLQTVECSEFQNMAFLQSLAKEELVEGIKRRIQIKKCKSLENLPLKITKNEATQNIKVEFQDELFKNTPKYSCNSLSPGVEKNCSFESHDYSFLPSEGCNNENNFEDDPHGVRLHTAENSLKLKKENLRNLAEKDDTKTTTKLLKTEKSVIASKLLLEESHLYQNKNNGLTSCLQSEKNKYSVEENNTGRKHRKKMKLSEKEEKNTDLTLPNVCNNSELMLQENQMGMEGKETDTLESKKSFLKALRKVNHTTLPPVDYLCLPETVGKTSSRHHVSAVLQKTLESSLKEDIKNASESLGCKSVEPEEYFKLAISSAVKSPSDSHHMGKRSPRGDCRSETEESKASCRRIIPMTGKRVWPFYSCARISAQNWKKTSLSDLNYSLPGSLENVRQHDSLIDQMNQTHLSDSKLLQPSLIERTIESSSKDVYDSALSCLSSGSSIEPTLMDIKEAIPHDIKTKLEEPSRNGTEVISNATEATQLSNITQSLTGNKKKKGNLSKLNLTVASQESQEANNCANKTVHRKACITKQTLVAPDLVKILNTGRLTNFKIPLLKNKTGKRGEVSARSSEREAYSPLELLDSLSGVEAKQNRNKENICTTSGPQSLNIHSSVTSGQTSSLNSFYNRNSCTSPSFTKKGYDNKACNHISEPGNIISNKESISIKIENNTFSCDLGYIEQNSFCSKKQEAFVPISSEISGRKMTKSISELKLGFPDILKAYEDDVLLIDVIQDDPELFGISNEGDLSFASEVSKISQEPRVSEEHPSADFKHMHLPGKKEPGDLSKEVAVLDPGLLKLEICPSLSAAKEPQHGPKGAAISLDATEETVVSENIEDLCEQARASDSDAKRLSSDKATVMEEQESTHEVCKSKDSRNVEAVASECQLATLGPSPLCSSALPLNLSSHQDVVPTPWINDFRFPGRHSVLQLQNPESCEIFKREKNMGMFQKPLGLVIPHRYCKLHFNTLRGCERAQCKFFHVPEQGDEKICMDVFKKYISVNEQCLLHRAAYIFLEYYRKFPPGIHFSLQVLNDLLISLLKHCLLKEVFQVVQLSIMAKMLPALKILLKIFEYVAAMKLRNAVPALIEIFCKFIEAGMVPDPEHLNYIVKLLHQAQASQQEISAVLEAKARLRVRQLKKNWKCDLDSALSEVETCKEKGDWTKLGNLYISIKMGCEEFADFQRFCACVAETLTEDYKEERPGVPFCEFAETVSKDPQYSEVDKTLLGRIGISAVYFYHRLLLWAKGRKVLDTLYELKIHFTSLKGLTGPEKVAPRCQIVNVAAEIFIKSGSLDGAIWVLRESEWIINTPLWPCDRMDMLNRHHLLCTIAREILGKNLYKQTFEVLRNLPGFQNSQETTGISQSSLLFNELLDACIESNSLGISSSVAEFMVAKSIPIDFSFLRRLITSLGRSCLWLKARAHYKSALSLGCYPPLEGNLYRKLLLVPSHLSEIEMLLAIEIFLVSNASIIQSPGTPTQMLQIVLKRCEESKSRSKDDYQAAAERLIVAARISDPKLFIKHMTVNINKEQVYSLEHCSALKWLKENMKWAGKVWLFTNH"
ORIGIN      
acttccgcttcctgttgcgtcgggtacagggtccgaagccaggccaggccaggccagggtgggcagtagcctgtgtcctgcagcgggagcagcggccccgaggcggcgaggcttccccgagaggctgagtgggcggccgtgggcggatgcggcccccaaggacgcccccaggccccaccacggcgccagggcgcaaaggctccacccgaggcctgaggaagcgaggccttccgctgacgctgacgccagagccaggcgagcggggaggctgcagactagaggccagggggcgcgaggaggagagcaggcagaagaggaggatggcccaggcttctgggagagaagggacagaaggtgacaagttggccaaagagaatggaaaacttactgaagccccaagtgatgatccacagccagggactgacctggtaagaaaagcatcaataaccagttcggaatctttgcaaacagtggagtgcagtgaatttcaaaatatggctttcttacagtctttggctaaggaagaattggtagaaggtattaaaagaagaattcaaattaagaaatgtaaaagtttagaaaatctacctctcaaaataactaaaaatgaggcaacacaaaatattaaggttgaattccaagatgaactgttcaagaatacgccaaaatattcttgtaacagcttatcacctggagtagaaaaaaattgcagttttgaatcacatgattacagttttctcccttctgaaggttgtaataatgaaaacaactttgaggatgatcctcatggtgtacgtctccacacagcagagaactctttgaaattgaagaaagaaaaccttaggaatcttgcagagaaggatgacacaaaaactaccactaagctcttaaaaactgaaaaaagtgtaatagccagtaagttactgcttgaagaaagtcatttataccaaaataaaaacaatggcttgacttcctgccttcaaagtgaaaaaaacaaatattcagtagaggagaacaacactgggagaaaacacaggaaaaaaatgaagttgtctgaaaaagaagaaaaaaatactgatcttactttgcctaatgtgtgtaataattctgagttgatgttacaagaaaaccaaatgggtatggaagggaaagaaacagacaccttagaatctaaaaaaagttttctaaaagctttaagaaaagtaaaccatactacactccctccagtggactatttgtgtctcccagaaacagtggggaaaacaagttctagacatcacgtaagtgctgtgcttcagaaaacccttgaatcaagtttgaaagaggatataaaaaatgcttcagagtccttaggatgcaaaagtgtggagccagaagaatattttaaattggcgatcagctcggcagtgaaatcacctagtgatagccatcacatgggaaagagatctccacggggagattgtcgaagtgagactgaagagtcaaaggctagctgtcgcagaataataccaatgactggtaaaagagtttggcctttttattcttgtgctaggatatctgcccaaaattggaaaaagacttccctgtcagatttaaattactcacttccagggtctctggaaaatgttaggcaacatgattctctaatagaccaaatgaaccagactcacttatctgactccaaactgttacaaccatccctaatagaaagaaccattgagtcctcgagtaaagatgtgtatgattctgctttaagttgtttgtcttcaggttcttcaatagaacctactttgatggatataaaagaagctataccccatgatataaagacaaagttagaggaacccagcagaaatgggacagaggtaatttctaatgctactgaagccacccagttaagtaatataactcaaagcttaacaggaaataagaaaaagaaagggaatttatcaaaacttaatttaacagtggcatcccaagagagccaggaagcaaataactgtgcaaataaaactgttcatcgaaaagcttgtattactaagcaaacacttgtggctccggacttggttaaaatattaaacacaggacggctgactaattttaaaattcctttactgaagaacaagacaggaaaaagaggagaagtaagtgccaggtcatctgagagagaagcttatagtcccctagagctacttgacagtttatctggagtagaggcaaagcaaaatagaaataaggaaaatatctgtacaacttcaggaccacagtctttgaatatacatagtagtgtaacttcagggcaaactagttctctgaattcattctacaataggaattcttgtacttctccaagctttacaaagaaaggttatgataataaagcatgtaatcacatctctgaaccgggaaatattatttcaaataaggagtctatttctattaaaattgaaaataatactttttcttgtgatcttgggtatattgagcaaaattccttctgctctaagaaacaagaagcatttgtgccaatttcatctgaaattagtggtagaaaaatgactaaaagcatttcagaactcaaattggggtttccagatattcttaaagcatatgaagatgatgtcctcttgattgatgtgattcaagatgacccagagctctttggaatctccaatgaaggggatctctcctttgcttcagaagtctccaagataagccaggagccaagagtatccgaagaacacccgtcagcagactttaagcacatgcaccttccagggaaaaaagaaccaggtgatttgagtaaagaagttgccgtgctggaccctggattgctgaaactggagatctgtccttccttgtcagcagcaaaggagcctcagcatggtcccaaaggggcagccatctccttggacgccactgaggagactgttgtaagtgaaaacatagaagacctctgtgaacaagcacgagcttcagactcagacgcaaagcgcttaagttcagacaaggcaactgttatggaagaacaagagagcactcacgaagtttgcaaaagcaaagattctagaaatgtggaggctgtggctagtgagtgtcagttagcaacactgggccccagccctctgtgctcgtcagcactgcctttgaatctaagcagtcatcaagatgtagtgcccacgccctggataaacgatttcagatttccaggaagacattctgttctacaactgcagaatcctgaaagttgtgaaatatttaagagagaaaaaaatatggggatgttccagaaacccttagggttggtgataccccacagatactgcaaacttcattttaatacattgcgtggttgtgagcgagcacagtgcaagtttttccatgtgcctgagcagggagatgagaagatctgcatggatgtgtttaagaaatacataagtgtcaatgagcagtgtttgctgcatcgggcagcgtacatatttctggagtactacagaaagtttcctccagggatacacttcagtttacaagtgctgaatgaccttttgatttctttactcaagcattgtttactgaaagaagtcttccaggtagtgcagctcagcataatggctaaaatgctgcctgctctgaaaatattactaaagatatttgagtatgtggcagctatgaagttaaggaatgctgtacctgctttaattgagattttttgcaagttcattgaagctgggatggtacctgacccagagcacttgaactatatcgttaagcttttacaccaagcacaggcatcccaacaagaaatatctgcagttctggaagccaaagccaggttgcgagtgaggcagctgaagaagaactggaagtgtgacttagactcagccttgagtgaagtagagacttgtaaagaaaaaggtgactggaccaaattgggaaacctgtacattagcataaaaatgggttgtgaagaatttgcagatttccagagattctgcgcttgtgttgctgagacactcacagaagattataaagaagaaaggccaggtgttcctttttgtgaatttgctgaaacagttagcaaagatccacagtacagcgaggtggataagactttgttgggaaggatcggaataagtgctgtgtatttctatcacagactgttgctgtgggccaagggaaggaaggtcttagatacactatatgagctaaaaatacattttacaagtttaaaaggacttacaggacctgaaaaagtagcacccagatgtcaaattgtaaatgttgccgcggagatttttatcaagagcgggagcctggatggtgccatttgggtcctgagggaatcggaatggataatcaacacaccactttggccttgtgatagaatggacatgctcaatcggcatcatttgctctgtaccattgcacgtgaaatcctgggcaagaatctttacaaacaaacatttgaggtcttgaggaatctaccaggctttcagaattctcaagaaacaacggggatttcccagtctagccttctttttaatgaacttctggatgcctgtatagaaagtaacagtcttggcatatcatcttctgtagcagagttcatggttgcaaaaagcatccctattgacttctcctttctcaggagactgatcacttccctaggaaggagttgcttgtggctcaaagccagagcccactacaaaagtgctctttccctgggttgctacccaccattagagggaaacttataccggaaacttctactggttccttctcatttatctgagattgaaatgcttttagctatcgaaatatttctggtgtctaatgctagtattattcagagcccgggaactcccacacagatgctacagatcgttttaaaaagatgtgaagaaagcaaatctcgaagcaaggatgactatcaagctgcagcagaaagactgatcgtggctgctcgaatatcggaccccaagcttttcattaagcacatgactgtcaatatcaacaaagagcaggtgtacagtctggagcactgttctgccttgaaatggctgaaagagaatatgaagtgggctggaaaggtttggcttttcactaaccattagttagtaaagggttgttgttgggttttctttttaagttcaagtaatcattgttgaaaataaaagaataaaaat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]