GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 05:47:50, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XM_033992496            2540 bp    mRNA    linear   VRT 05-JUN-2020
DEFINITION  PREDICTED: Acipenser ruthenus testis and ovary specific PAZ domain
            containing 1 (topaz1), transcript variant X1, mRNA.
ACCESSION   XM_033992496
VERSION     XM_033992496.2
DBLINK      BioProject: PRJNA635364
KEYWORDS    RefSeq.
SOURCE      Acipenser ruthenus (sterlet)
  ORGANISM  Acipenser ruthenus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Chondrostei; Acipenseriformes; Acipenseridae;
            Acipenser.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_048326.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 5, 2020 this sequence version replaced XM_033992496.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Acipenser ruthenus Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2540
                     /organism="Acipenser ruthenus"
                     /mol_type="mRNA"
                     /isolate="Gen_M01"
                     /isolation_source="water"
                     /db_xref="taxon:7906"
                     /chromosome="4"
                     /tissue_type="testis, blood"
                     /country="Germany: IGB"
                     /lat_lon="52.448940 N 13.648750 E"
                     /collection_date="2018"
     gene            1..2540
                     /gene="topaz1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:117394339"
     CDS             20..1594
                     /gene="topaz1"
                     /codon_start=1
                     /product="protein TOPAZ1 isoform X1"
                     /protein_id="XP_033848387.2"
                     /db_xref="GeneID:117394339"
                     /translation="
MTRLLYRLLNESQMKEVFTVLQIVVLVKMLPPSDLLLQVFQRVTLLGLRKAVPSLIDVTCKCVDAGLELTVENFNYMQRQLDLLQAPREEIDVFLAVKSRLLEKQATRNEQFDLDVAVAEVEHCKEQQDWAKLGTIFINVCLGYRNLGELNRFCSCIASSLIKDVKETPMIPFREFAEKVCQEPHVSGLDKSLLGRIGISVLFGYYKAQHWTKGRRLLDTLHGMKIHFSTLKGLLGNDCYASRCQILNIAAEIYLNSGNLEKAVSVLKESDWIISTPVWPCDNMDVLNRHNLLCRMAEESAIKNLHREALEVLKKLPGLQNFSDNVDVSRYTMIFNRHLSACIENQNLAVSSNTVDFMTSKSIPVDFSLLRKLIFKLGKNSLWLKARSLYKSAVSMGCYPALQGNLYCRILSIPYSLSEIEMMLAFEMFIVSNAGNIQNPSPFNQALQIVLKRKEEDDVCLSDNDYHAAMSRLMLAAQNTNPKLGIKYATVNVCKEQVFTLDHLSALKWLNKNMKWAGKVWLFS"
ORIGIN      
tcattttaattccgaagtcatgacccgtctgctgtacagattgcttaatgagagtcagatgaaagaagtcttcacagtgcttcaaattgttgtgctggtcaaaatgttgccaccatcagatcttctacttcaagtatttcagcgtgtgaccttattgggcctcagaaaagcagtaccaagtctgattgatgtaacatgcaagtgtgttgatgcaggcttggagctcacggtagagaactttaactacatgcagcgacaacttgatctactgcaagcaccaagagaggagattgatgtctttctagcagtcaaatcaaggttactggagaaacaagctacgagaaatgagcagtttgatctagatgttgcagttgctgaagtggagcattgtaaagaacagcaagactgggcaaagctgggaacaatcttcattaatgtgtgcctcggttacagaaatcttggtgaactcaacagattctgtagttgcattgcatcctcacttataaaagatgtaaaggaaacacctatgattccattccgtgaatttgcagaaaaagtgtgtcaagaaccccatgtaagtggattagacaaaagcttacttggcaggattggaatctctgtattgtttgggtactacaaagcacagcattggaccaagggaagaagattgctagatactttgcatggaatgaagattcatttttcaacactgaaagggcttcttgggaatgattgttatgcatccagatgccagattctaaatattgctgcagaaatctacctgaacagtgggaatctggaaaaagcagtatcagtgttaaaagaatctgattggataatcagcacacccgtgtggccttgtgacaacatggatgtcctgaaccgccataacttactttgtagaatggcagaagaaagtgcgatcaagaacttgcacagagaagctcttgaagttttgaaaaaactgccagggctccagaatttctcagataatgtggatgtttcccgttatacaatgatattcaacagacatttaagtgcttgcattgagaaccagaatctggctgtgtcttccaatactgttgatttcatgacttcaaaatcaattccagtggatttttccttgcttagaaagttaatttttaaattaggaaaaaacagtctttggttgaaagctagatccctctacaaaagtgctgtctcgatgggttgttacccagcactccaggggaacttgtactgcagaattctttccattccctattctctgtctgagattgagatgatgttggcctttgaaatgtttattgtttcaaatgcaggcaacattcagaaccctagtccttttaatcaggctcttcaaattgtacttaaaaggaaagaagaagatgatgtatgtctcagtgacaatgactatcatgcagcaatgagcagactaatgttagctgcccagaataccaacccaaaactgggcatcaaatatgcaacagtaaatgtttgcaaggaacaggtgttcactttagatcatttatcagcactaaaatggctaaacaagaatatgaagtgggcaggaaaagtctggttattttcatagtgctggagcataaatttattttggagattacttttgtttaattgaagcctgtaaataatgtgcaggttgttctatttaaaataaagcaagaatgctctattttacacacacacaaaaaaaaacctaaatcttatttcaattctacaaaacatagcttattagtttgcaccagaaaagtaaagtgtgaatttcagttctagtactggaagttaatctttctgtatgtttaagtttaaagaaaagtttaactgaagaaaaacacagctactttagagaatgagagttagtttcctagatatgaaagatatctaagttagtactgtatatagttattgaacttaccattcttttttttataattttattttattctatcgagattctgccagtttgattgttatagggtaatttaataaatatactctatttaaaattagaaacggatataatggctatattgtttatagattacatcaaagggttgggcatatacaagcacacacaccacacatgcatgcattatgcagatacagacagatggtgcatgcaaatatacattttgaaataagcacagcaggtatgacaacatgatgcagtgttttattttttccaatagaatggcaaagacattcctgataggctttaaagtttaatttaagcatgtttgctaaaaaggaggtaggtggttcaaaataataaataaaaagttgaacagaactgatttgttaaactatacaataacggtctgttttgactgggtaataaagttttttgtatacatgtaatgtatatgtacataagcaataaagattaatttgtttggtcttttaatgagtcctttcaacatttctacaatttttaaaaataattaatgtatatgaagcatacgtgggatccttggagggggttaaattataaaatactggccattgtaacaagaaaaaat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]