GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-26 23:28:15, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XM_033952853            4087 bp    mRNA    linear   VRT 28-APR-2020
DEFINITION  PREDICTED: Geotrypetes seraphini NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X2,
            mRNA.
ACCESSION   XM_033952853
VERSION     XM_033952853.1
DBLINK      BioProject: PRJNA627137
KEYWORDS    RefSeq.
SOURCE      Geotrypetes seraphini
  ORGANISM  Geotrypetes seraphini
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Gymnophiona; Geotrypetes.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_047090.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Geotrypetes seraphini Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4087
                     /organism="Geotrypetes seraphini"
                     /mol_type="mRNA"
                     /db_xref="taxon:260995"
                     /chromosome="7"
     gene            1..4087
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 4 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:117364064"
     CDS             176..3148
                     /gene="NRDE2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2 isoform X2"
                     /protein_id="XP_033808744.1"
                     /db_xref="GeneID:117364064"
                     /translation="
MIIVTYTVYKHMYKRKGNTCLGINPKKQCITWEDSATGKKSLHKRAERYFTKSGVQLLAADGTPVYSRTRATPLWDSTLIPLLEGDEDGKAACPSTAWVNPLGVYDMSTTLWLQGKGLPESEAKYPASSDDLNNTLKAKVEEFNRKLRESPEDVQTWLAFVAFQDELMKGPSMYTIDEKQLESRRKSLRLILEKKLSILDRAIESNPHQVELKLTRLKLCEEFWEPAVLLKEWQKLVFLHPNDAVLWQKYLLFAQSHFSTFSMSKVISTYGKCLSTLAAVQDGSMVSHPLLPGTEEAMSAIFLQQCHFLRQAGQSEKAISLFQAMSDFTFFKPDSVKDMSTKRQVEFFEPFWDSGEPRFGEKGAKGWNAWMRQQERGGWIVVSNFDEEEEEDNAEDEPEIKDKTCPRWRIWLEMECAREAKHWLPWRPDKAKGQSEEDCEDPERQVLFDELGPSLFRISSSELKFQLMCAFLQFLGVPCGCHLPASCLYLAMDENSVFDCGHASERTLTPFDCLSSGVGTLGHMETMVTGRRQTGHPKEGEEFLQNIFRLAQSCFSGEAKSHFLVCWFQYEISKIAWYLRVKDKKHLKSQGKKSKKLAKHLLKEAENRNNLSLWKEYAYLEWLLGNIDDSRKVFDTAISMGKNSGMKNRGLLNLCLLYAELEVGLLNTLEGAVNSRAVHVLTKLADNGPYAPYNGQMFSVSILKARKVYEHAVQDCLQESLSSGLGKPPVQLVSLVGCFALFQYLTVGLDAAVQVFRLFTDKRDSVSVLKAGEFNETPNSWAALETLSAMQTSLLRYHLKMGVHPLNPLRETLREALTLYPGNRFLWQSYVEVESKSHNASKMRRFFDRVRRSTVCLEPWLFAIQAEQARKRLVESVQRKDAGEIHATIPETGLTNRIQALFEHAIGSQQGAHCPLLWRLYLHFMVSLGNKERSKGLFYKALQSCPWAKVLYLDAVEYFPDELQEILDLMTEKELRLRMPLEELDLLLED"
ORIGIN      
caaatagtgtaaaaaatcacttggtttggctcgaggatattgaatctgtgaatggtgaggccttcagaattgataagaaccctgaccctgctaactgggaatacaagtccctttacagagcacatatagcaaggatgatgattatcgaaatactctgaaaatgtgagctgtttgaatgatcatagtcacatacacagtctataaacatatgtataaaaggaaagggaacacctgtcttggtattaatccaaagaagcaatgtataacttgggaagattctgccactggaaagaaatcgctccacaagcgggcagaacgttactttactaaaagtggggtacagttactcgctgcagacgggactccagtgtatagcagaactcgggctacccccctttgggacagcacactcataccgcttctggaaggggatgaagatgggaaggctgcctgtccatccactgcctgggttaatcccctgggagtttatgatatgtccactacattgtggctccagggaaaggggcttcctgagagtgaagccaaatatccggcttccagtgatgatttaaacaatacactgaaggcaaaggtggaagagttcaaccgcaagctgagagagagtcctgaggatgtccagacttggttggcctttgttgcttttcaggatgaactgatgaagggacccagtatgtacaccatcgatgagaaacagctagaaagcagaagaaagtctctgaggctgatcttggagaaaaaactctcgatcctagacagggccattgagagcaatccgcaccaagtggagctgaagctcacaaggctgaaactgtgtgaagagttctgggagccggctgtgctcctgaaggagtggcagaagttggtgtttctgcatcctaacgatgctgtactgtggcaaaagtatctcctgtttgcccagagccatttcagcaccttttccatgtccaaagtcatcagtacctatgggaaatgtttgagcaccctggcagcagtgcaggatggcagtatggtgtcccaccccctacttccaggcacagaggaagccatgtctgctatcttcctgcagcagtgccacttcctccggcaggcaggccagtccgagaaagccatctccctcttccaggctatgagcgatttcaccttcttcaaacctgacagcgtcaaagacatgtcaacaaagcggcaggtggagttttttgaacctttctgggacagcggagagcctcggtttggggaaaaaggcgccaaaggctggaatgcgtggatgcgtcaacaagaaagaggaggctggattgttgtcagtaactttgatgaggaggaagaagaagataatgcggaggatgaaccagaaataaaggataaaacttgtcctcgatggcgcatctggctggagatggagtgtgcacgtgaagctaaacactggctaccctggagacctgacaaagcaaaaggccagtcagaagaggattgtgaggacccagagagacaggtgttgtttgatgaactgggtccatctttgttccgaatttccagctctgagctgaaatttcagctgatgtgtgcattcctacaatttttgggggttccatgtggatgccatcttcctgcttcctgcttatacctagcaatggatgagaattctgtctttgactgtgggcacgcttctgagaggacactgaccccttttgattgcctgtcctctggagttggcactcttggccatatggagacaatggtcacagggagacgacagacagggcatcctaaggaaggagaggagttcctacagaacattttccggttggcacagtcttgcttctcaggggaggcgaagtctcatttcttagtctgttggtttcagtatgaaatatcaaagattgcatggtatttacgagtaaaagacaaaaagcacctcaagtctcaagggaaaaagagtaaaaagctagcaaaacatcttcttaaggaagcggagaaccgaaacaatctttccctctggaaggaatatgcctacctggagtggctgctgggaaatatagatgattcccgtaaggttttcgatacagccatcagcatgggtaaaaacagcggcatgaaaaaccgcggccttttgaacctgtgtctgctttatgctgaactggaagtggggctgctgaacaccctggaaggagccgtcaactcgcgtgctgtccacgtcctgactaagctggctgacaacggaccctatgcgccttacaacgggcagatgttctcagtcagcattttgaaagcccgtaaggtatatgagcatgcagtgcaagactgtctgcaggaaagtctgtcctctggcctcggaaagcctcctgtccagcttgtgagcttggtgggttgttttgcactcttccagtatttaactgtaggacttgatgctgcagttcaggttttcagactttttactgataaacgggacagtgttagtgtcctgaaagctggagaatttaatgaaacaccaaattcttgggctgcccttgaaacgctttccgcgatgcaaacaagtttactcaggtaccaccttaaaatgggcgtgcaccccttgaatcctttgagagagacactcagggaggctctgaccttgtatcctgggaaccggtttctgtggcagtcctacgtggaagtggaaagtaaatcccacaatgctagtaaaatgaggagattttttgaccgtgtccgaagatccaccgtgtgccttgaaccatggctcttcgcgatccaggccgagcaagccagaaaaaggcttgtggagtcagttcagaggaaagatgcgggagagatccatgcgacaatccccgagacgggcctgacaaatcggatccaagcgttatttgaacatgccattggaagccagcagggggctcactgcccactcttgtggaggctgtatttacatttcatggtttcattaggaaataaagaaagaagtaaaggactgttttataaagcacttcagagctgtccctgggccaaggtgctgtacttggatgcagtcgagtacttccctgatgagctccaggagatcctggatcttatgacggagaaagaactacgtttgcgcatgcctctggaagagctggacttgctgctggaagactgaaaaaaagagaagggggggagggaagaaagaacagaaactggagtgcagcatgacccagacagagcctctgagcttttagaaatgtgctaaaagctcaagtaccttgaattgaaaaaggcaggacaacacagcctggaaggaacagtctgaacgtcgagttcctgcttcccaggaccattgtgttagccagtccatcccactgtgagaaggaaaggacaatagagggggaagtcttccaatgctgaaaactagggtcctggatgttttcagctcggtcttccgacttggtgacatcttgggacagtttatccatgtgcagacacagtgagctgcatttttcgaaaggttctgcttctaccacattgccaaaatgttggttttaaagaacacttcaaaactaacttactgatttacagtgaagccaccgcatgcattgtacaggaatagaacaacatatcagccactttaagtggtagattctgtcattgcagggacacagctttaattctctaattcaatgtaaatatagtgtgtgtgtatttggggggggggagggagggaatgggggtaagggtggagaggttcagcacaatgcactctgaatttcccaagccatgatgagtacaatacaggtgacagagcaggcttcagatcggggagtggataagtagaaatacaaatgaaagaaatgtgttctgtctgccataatccctggtctccttttgctggactgcggttacctactttggggatatacatcttacaattgagcgtctattcttttacatgtggaataaacaggttaaaactgtcatcagactaagggcgacttttaatcacgtgctaaccaaaaagctactgcctgctcaaggcaggcgttagcggctagcggtttaacgcacgctattacgcgcgttaaaccgctagtgtggcttgata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]