GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:17:35, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_031719924            4959 bp    mRNA    linear   PLN 27-NOV-2019
DEFINITION  Blastomyces gilchristii SLH14081 RNA interference and silencing
            protein (BDBG_00523), mRNA.
ACCESSION   XM_031719924
VERSION     XM_031719924.1
DBLINK      BioProject: PRJNA41099
            BioSample: SAMN02953742
KEYWORDS    RefSeq.
SOURCE      Blastomyces gilchristii SLH14081
  ORGANISM  Blastomyces gilchristii SLH14081
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Eurotiomycetes; Eurotiomycetidae; Onygenales; Ajellomycetaceae;
            Blastomyces.
REFERENCE   1  (bases 1 to 4959)
  AUTHORS   Champion,M., Cuomo,C., Ma,L.-J., Henn,M.R., Klein,B., Goldman,B.,
            Young,S., Kodira,C.D., Zeng,Q., Koehrsen,M., Alvarado,L.,
            Berlin,A.M., Heiman,D.I., Hepburn,T.A., Saif,S., Shea,T.D.,
            Shenoy,N., Sykes,S., Galagan,J., Nusbaum,C. and Birren,B.
  CONSRTM   The Broad Institute Genome Sequencing Platform, Broad Institute
            Microbial Sequencing Center.
  TITLE     The Genome Sequence of Blastomyces dermatitidis strain SLH14081
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 4959)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (27-NOV-2019) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 4959)
  AUTHORS   Champion,M., Cuomo,C., Ma,L.-J., Henn,M.R., Klein,B., Goldman,B.,
            Young,S., Kodira,C.D., Zeng,Q., Koehrsen,M., Alvarado,L.,
            Berlin,A.M., Heiman,D.I., Hepburn,T.A., Saif,S., Shea,T.D.,
            Shenoy,N., Sykes,S., Galagan,J., Nusbaum,C. and Birren,B.
  CONSRTM   The Broad Institute Genome Sequencing Platform, Broad Institute
            Microbial Sequencing Center.
  TITLE     Direct Submission
  JOURNAL   Submitted (06-FEB-2009) Broad Institute of MIT and Harvard, 7
            Cambridge Center, Cambridge, MA 02142, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_003101682).
FEATURES             Location/Qualifiers
     source          1..4959
                     /organism="Blastomyces gilchristii SLH14081"
                     /mol_type="mRNA"
                     /strain="SLH14081"
                     /db_xref="taxon:559298"
                     /chromosome="Unknown"
     gene            1..4959
                     /locus_tag="BDBG_00523"
                     /db_xref="GeneID:8507895"
     CDS             273..3401
                     /locus_tag="BDBG_00523"
                     /codon_start=1
                     /product="RNA interference and silencing protein"
                     /protein_id="XP_031575846.1"
                     /db_xref="GeneID:8507895"
                     /translation="
MSGQQPRGQRGRGGGRGMGGDPGGQRGGQRGRGSDRGRGPHPIFDAPSGGRGRGDRGGFRGDRGGRGDRGGFRGGRGGGTRGPEVYSQASGGIPAPDPKVKKVENSYKGPAGSGKELSLESLSINRNFPLRPAFGTQGRPVLLWANYFEIVSSFNLTLHRYKVEVQEQDGKTPAGKKLKRIIELLLEEHFGNMKNQIATDYKATLVCKTAINLPQEMFSITYRLEYEDEPAPRARTYKVRVVAIGSLDVAPLLQYLSSPRSGEQLPAKEEIIQALNIVLGHNPKTNRELLSIGANKHFPLGRGGESYDLSGGLTALKGFFVSVRATTSRLLVNVQVKATPCYSEGSLPDIMNSFSASIRGPTHFHKLNRFLKRVRVSVNHIVRKNKSGRVILRIKTIEGLAHQSDGRYLQNPPQVPWLGAGPKDVKFFPDGPTPPAEGQSKKNGKKQKKGPVKPGGDSSTGSYISVYDYFKRNYPNIPELNNALPVVNVGSKEEPIYLPAEVCHVLPGQPANAKISPQQTQNMIRFAVRRPVENAKSIVVNGTQVLGFTPHLNPMLAGMGLSLLPNLITVPGRVLEGPAIIQYKGQSFKSPHGGNWNLQKVAFSHGSQLPAWTFLYYQDGRTDPAVVMESVDRFIDMARVQGLAVPVPSRPIAVNVPPRRDVEDIPLDPIFAEIRQQSRVRLVLVILPFASPQIYSQVKYRGDIKDGIHTICVVAEKFRKNQPQYFANVALKFNLKLGGVNHKLQPSKLGVISEGKTMVVGIDVTHPAPGSLSTAPSIAGMVASVDKVLGQWPATIRLQQQARAEMVSDLDIMLQSRLRLWQKNNSKSLPENILIYRDGVSEGQYGKVLDEELPLLRSACKAIYPADKTKKGLPKFTIIIVGKRHNTRFYPTDLKDADNNSNPNSGTVVDRGVTESRHWDFFLQAHTALQGTARPAHYYVILDEIFTGRKTAGRFDSIADELEDLTHNLCYLFGRATKAVSVCPPAYYADLVCERARRYLSRYFDVTPDTSVASSGASDVGPVPIGDDVRIHSDLVDTMFYI"
ORIGIN      
gatccctacggcaacgccactggagccgctacacttagttggttacaccccaacaaaaaaacaaacaaaacatgccaagaatggcaaagagacagttggcaacgagttacataccctgcaaacttagcgctgggattgaggcctccagcaggggtcccgtcattcactggagcctcatctcaaatccacggctggtctgaaggatatacagtagtcagcttaatcccgattttttttgattgtatcattcttttccctaaccaagcagccaaatgtcaggacagcagcctcgaggtcagagagggcggggcggagggaggggaatggggggagaccccgggggtcagcgaggtggacaacgtggacgcggctctgaccgtggccgaggtccacatcctatcttcgatgcgccatcgggcggacgagggcgtggtgaccgtggcgggtttaggggagatcggggcggccgtggtgatcgtggtgggtttcgcggaggacgaggaggcggaactcgtgggccagaggtgtattcccaagctagcgggggtattcctgctccggatcccaaggtcaaaaaggtcgagaatagctataaaggacctgctggctccggaaaggaattgagtttagaatctctttcaattaacaggaatttccctctaagaccagccttcgggacacaaggaagaccagtcttactgtgggccaattatttcgaaatcgtctcaagcttcaatctcaccctgcaccgctataaggtggaagtccaggaacaggacggtaaaacccctgctggcaaaaagcttaagcgtattatcgagcttctgttggaagagcacttcggaaacatgaaaaaccaaattgcaactgactacaaagcaacactggtctgcaaaaccgcaatcaaccttccccaggagatgttttcgataacgtatcgtctcgaatatgaagatgaacctgctcccagagccaggacttacaaggttcgggtcgtcgcaattggttctctcgatgtggcaccgttgctccaatatctctcctcacccaggagcggggaacaactcccggccaaagaagagatcatccaggcattgaatatcgtcctgggccacaaccccaagacaaatcgcgaattgctttcaattggcgcaaacaaacactttccacttggccggggcggggaaagctatgatctttctggtggactcactgcactcaagggcttcttcgtcagcgtccgtgccacgacttcccgcctccttgtgaatgtccaagtcaaagctaccccgtgctacagtgaagggagcctgccagatattatgaacagcttttcagccagcatacgaggccctacgcactttcacaaactcaaccgattccttaagcgagtacgcgtgagcgtcaatcatatcgtccgcaaaaataaatcaggcagggtcatattgcgaatcaaaactattgaaggtcttgcacatcagagtgatgggcgttatttgcagaacccgccacaggtaccttggctaggagcaggtccgaaagatgtcaagttctttcctgatggaccaacacccccggcagagggccaaagcaagaagaacgggaaaaaacagaaaaagggccctgtgaagccgggtggagattcttctacgggttcatatattagcgtctacgactattttaaacgcaattaccccaatatccccgagttgaacaacgcattaccagttgtcaatgttggcagcaaggaggagccgatctacctgcctgctgaggtctgccacgttctgcctggccagccggcaaatgccaaaatctccccccaacagactcagaacatgattcgctttgcagtccggagacccgtggaaaatgccaagtcgattgtcgtaaatggaacccaggtgctcgggtttaccccacatttgaatcctatgctggctggtatgggattatctctgttgccaaacttgattactgttcctggtcgagtgctggagggtcccgctattattcagtacaagggacagagctttaaaagccctcacggcgggaactggaaccttcagaaagtcgcattctcacatgggtcccagctacctgcctggacattcctttactaccaagacggccgaaccgatccagcggttgttatggagagcgttgatagatttatagatatggcaagggtacaagggctcgctgttccagtgcctagccgtccaatcgctgtcaacgttccccctcgtcgagatgtggaggatataccactggaccccatctttgccgagattcgccagcagtcgcgagtgagattggttctggtgatcctaccttttgcaagccctcaaatttacagccaggtaaagtataggggagatatcaaggacggcatccatactatttgcgtagtcgcagaaaagttcaggaagaatcagcctcaatacttcgccaacgttgcgctaaaattcaacctgaagctcggaggagtcaaccacaaacttcagccgtccaaactgggggttatatcggaaggtaagacaatggttgtgggcattgatgtcacgcatcctgccccgggttcgctctccactgcaccaagcatagccgggatggttgcaagcgtggataaagtcctcggtcaatggcccgccaccatccgtcttcaacagcaggctcgcgcagagatggtgagtgatcttgatataatgctccaatctcgtcttcgcctttggcagaagaacaactccaagagcctcccggagaatatcctgatctaccgcgacggggtatcagaaggccaatacggcaaagtcctggacgaagaactacccctgctccgcagcgcgtgcaaagctatctacccagccgacaaaaccaagaaaggcctccccaaattcaccatcatcatcgtcggcaaacggcacaatacgcggttctacccaaccgatctcaaggacgcggacaacaactcaaatcccaacagcggaaccgtcgtcgaccgcggcgtcaccgaatcgcgccactgggatttcttcctccaagcccacaccgcactgcaggggaccgctcggccagcccactactacgtgatcctcgatgagatattcaccgggcggaagactgcaggccgcttcgacagcattgccgatgagcttgaagacctaacccataatctctgctacctgttcggacgagcaaccaaggccgtcagcgtctgcccgccggcgtactatgcggatctagtctgtgagcgcgccaggcgctacctaagtcgatatttcgacgtcacgcctgacaccagtgttgcttcgtctggtgctagtgatgtgggtcctgtgcctattggtgacgatgttcgcatacattctgacctggtggatactatgttttatatctgagtgatatctgcgtatatatcgtgtcgaagggaaggggggtatcttgggatcggggaagttgtggaaaatgctatggaggttgtgaagtcagtatggaatagtacagtcattgctctgtcattagtggtattttgaaatcttgattttgctttttagggttggttattggtctatttaccgtgatcatatctgagtatatgattgggcacatatcaaattgataagttgacacagagctttacgagaatgcaattctaaactaatgtcttggatatttctcagagagtttatctagcaaatgggtattaattgagtgatcagagttcaatcccatgcaaacctccaactactcaaatatactccgtgccaaaagctcattatcatcaccaaaatatccaccataccttcatattcatacatagagcgcacctgtcgaaatgcaaatgtacaaccttttaatcccaataaaaaaatcaaaagaaaaaaagccagctagagaaaaagagaaacctcccctccgccaatatcaccgaacaagccctactaccccccttccccccaacgaccgcacaacccccttcttcagccgaaactgcctctcaatcacctcctccgacacccctcccttatccctcatcgccaaaatatgcctaatactcacgacatccaaaaactcgcgcccggaatggctcggtcggccaacggactcgagttcgagttcggcggccttctctaaccgggcgcgggaggagagaacgaggagggctgggttggaggatgtggaggaggaggtggagggggggaagacgatggagagggattgctgaagctgcgggttttggggttggttgaaagggttgggggtgacgggcccgatggagcggagggaggcggcgaactgaggatcgcgggcttcgaggtcgatggctgtggttatttgaggccgggttcgctcgccttctcttctgcatggaatactggtcctggctgttcccgtcggcttgatgccctggccgctggatccgcggctctggcaccaccgggcccggtggtcggtgcggagggtttcttggggtattgacgccgtgcagctgcattagctgccgcctttatgggtttcgacgatgatgcgcccattgcaattttgtgtgtgcagcgttactggggagtcggagaacgatactgtacagtaactagctcggtgagcggagaatgatggatggttttgcggagacggtccaagcttctacgggggccaaagctgacaggaatgtaggtttggtggaacgctaatttgcgtctagggctagaaggtggggaggggagagcagaataaataagacacacaggtgttctaggaatcgcatgcatgggttctactaaataaataacgacctagagatacatctgttcatgaaaaaagcgctaggaagattccagctccaaagtgaagattctttgtcatatgccattttgccccgaatagcatgacgaaaaagcattagcaaaaccagaccccctagcgcagccctgcgaggcgcctctcctggacctcgct
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]