GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-11-16 05:10:13, GGRNA.v2 : RefSeq release 96 (Sep, 2019)

LOCUS       XM_030558936            4116 bp    mRNA    linear   VRT 24-AUG-2019
DEFINITION  PREDICTED: Gopherus evgoodei NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X5,
            mRNA.
ACCESSION   XM_030558936
VERSION     XM_030558936.1
DBLINK      BioProject: PRJNA559383
KEYWORDS    RefSeq.
SOURCE      Gopherus evgoodei (Goodes thornscrub tortoise)
  ORGANISM  Gopherus evgoodei
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Testudines; Cryptodira; Durocryptodira;
            Testudinoidea; Testudinidae; Gopherus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044325.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Gopherus evgoodei Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4116
                     /organism="Gopherus evgoodei"
                     /mol_type="mRNA"
                     /db_xref="taxon:1825980"
                     /chromosome="4"
                     /sex="male"
                     /tissue_type="whole blood"
                     /ecotype="Sinaloan lineage"
                     /country="Mexico: Sonora"
                     /collection_date="2010-08-10"
                     /collected_by="T. Edwards"
     gene            1..4116
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 2 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:115649858"
     CDS             527..3403
                     /gene="NRDE2"
                     /codon_start=1
                     /product="protein NRDE2 homolog isoform X4"
                     /protein_id="XP_030414796.1"
                     /db_xref="GeneID:115649858"
                     /translation="
MVEKKQSHKRPERYFTKNSVQLLSTDGIPVYSKSQTSSSGPSTFIPVSQLDSDAPPPTTCVNPLGIYDPLTTLWLEGKGPPEHETLKQQASQETSENVNSILKAKVEEYNRMVRENPRDVHIWMEFVSFQDEVMRGPSPYAIKDGEQEIRRKSFKLILEKKLAILERAIESNPNDVDLKLAKLKLCTEFWEPSSLIKEWQKLVFLHPNNPVLWQKYLLFCQSQFSTFSVSKVHSLYGKCLSTLAAVQDGSMVSHPVLPGTEEAMLAVFLQQCHFLRQAGHSEKAVSLFQALIDFTFFKPDSVKDLPTRGQVEFFEPFWDSGEPRFGEKGAKGWKSWMHQQEKGGWIIINKPDEDEEDVDEDQEIKDKTLPKWQIWLDIECSRETRHWLPWRPDKTKKQTEEDCDDPERQVLFDDLGPSLIRLSSPDLQFQLLYSFLQFVGVPCGRSLFPSNLYIAMDENNIFDTEQSERPLTTFDSLLSGVNSIGHMDTMTRGRQHIGHCKEGEEFIQNVFHLILPLFSGKEKANLSVCWLQYEISKVVQCLQAKNKKKLKSQGKKSKKLAKNLLKASENRNNLSLWKLYAYLEWLLGNTEDARKVFDTALCLAGTEGMRNTQLCNLSLLYASLEVELLENLEETVMSRALHILTKLAESGPYVPYTGQLLSVNILKARKAYEHALQDYLSESPVSNWDQASSSSQLVNLVGCYALFQYLTVGIDAAVLICRHISEKLKGSASQKFESIGENLGIHNFPTALEAVTLMHTNLLRYHMKVSIYPLNPLREVLMEALKLYPSNQSLWRSYIQIQSKSHNASKARRFFDSVTRSTKSLEPWLFAIQAEEMRKKLVENVQRVDVGEIYSTIPETGLTNRIKALFEHAIQSENGAHCPLLWRMYLNFLFSLGNKERSKGLFYKALQNCPWAKVLYMDAIEYFPDQLQETLDLMTEKELRVRVPIEELELLLED"
ORIGIN      
cagcagagaccttcaggacagacaagaatccagaccctgcaaactgggaatacaagtcactgtatcgaggggacatagcaagtgattgtgcagagtgccactcacagcaccaaccatggcaatggcgattttagctggtatctcactcctgaaggtggtaaaggcacagagaacatagctgtgctggtccccagagctgtttaggcccgtatgctgctagcctgtttactgcaatggtgcctgccaaagttatcgctgactggcatgggaaagtgtcctactgtggaggaagaaataaggctgccatcccatgaaagcttcaggagaggattgcagtgtacctccatgaaaacttcattgagattgctcaggaggattcaaggggcatccctgtgtacataaacaaactgctctgcatggccccctgcctaactctagagggagaatgaaaaactgatacaagcggaaaggggactcatgccttggtattgacctaacgaaacaatgtataacttgggaaagttccatggtagaaaagaaacagtcccacaagcgacctgaacgctacttcacgaagaatagtgtgcagttattgagcacagatggaattccagtttacagtaaaagccaaacttcttcatctggtccaagcacttttataccggtttcacaactggacagtgatgctcctcctccaacaacctgtgtgaatcctcttgggatttatgatccattgaccacactctggttggaaggaaaaggtcccccagagcatgagactttaaagcagcaggcatcccaagagaccagtgagaatgttaactctattctaaaggcaaaagtggaagaatataataggatggtcagagaaaatccaagagatgttcacatttggatggaatttgtttcttttcaggatgaagtaatgagaggacccagcccttacgccatcaaagatggagagcaggaaataaggagaaaatcattcaagctaatcctagaaaagaaactggccattttagagagagctattgaaagcaacccaaatgatgttgatctgaaacttgccaagctgaagctttgtacagaattctgggaaccatcaagtttgatcaaagaatggcagaaactggtttttttgcatcccaataatccagtcctgtggcagaaatatctcttattttgtcaaagtcagttcagcaccttttcagtttcaaaagtccatagtttatatggaaaatgtttgagcactttggcagctgtacaggatggcagcatggtatcacatcctgtactgcctggcacagaagaagctatgttagctgtctttcttcagcagtgccattttcttagacaggcgggccattctgagaaagctgtgtctttgttccaagccctgattgacttcaccttctttaaacctgacagcgtaaaagatctgccaacaagaggacaggtggagttctttgaaccattttgggatagtggagagcctcggtttggagaaaaaggagcaaaaggctggaaatcatggatgcatcaacaagaaaagggaggctggattatcatcaataaacctgatgaggatgaggaagatgtagatgaagatcaagaaataaaggataaaactctacctaaatggcaaatttggctggacattgaatgttcccgtgaaacaaggcattggctgccttggcgacctgacaaaactaaaaagcagactgaagaagattgtgacgacccagagagacaggtattgtttgatgatcttggtccatctttaatcagactttctagtccagatcttcagtttcagctgctatactcatttctgcaattcgtgggagtcccatgtgggcgtagtctgtttccttcaaatctctatatcgctatggatgagaacaatatctttgacactgagcagtctgagaggccattgacgacttttgactcactgctttctggagtcaatagtattggccatatggacacaatgacaagagggagacagcacataggacactgtaaggaaggagaggagttcatacagaatgtctttcatttaatattgccgttgttttcaggaaaggaaaaggcaaacctttctgtctgttggctacaatatgaaatctcaaaggttgttcagtgtctccaagcaaaaaacaagaagaaactgaagtcacagggaaagaaaagcaaaaaactagccaagaatctccttaaggcatctgaaaaccgaaacaacctttccctctggaaactgtatgcctacttggaatggttacttggcaacactgaagatgctagaaaagtgtttgatacagctctttgcttagcaggcactgaaggaatgagaaatacccaactctgtaatctgagcctgctttatgcttcactagaagtggagctactagagaatttggaggaaactgttatgtcacgtgctttacatatattgaccaaactggctgaaagtggaccatatgtaccttatactgggcaactgctatctgtgaatatcttgaaagctcggaaggcatatgagcatgcattgcaagattatttaagtgaaagtccagtctctaattgggatcaagccagcagttctagccaactggttaatttagttggttgttatgcacttttccagtatttgactgttgggattgatgctgctgtgttaatatgtagacatatttctgaaaagcttaaaggttctgcttcacagaagtttgaaagcattggagaaaatcttggcattcataatttccccactgctcttgaagctgtcacactcatgcacacaaatttactcaggtaccatatgaaagttagcatttaccctttaaatccactgcgagaggtactaatggaagctttgaagctgtatcctagcaaccagtctctttggaggtcatatatccagatccaaagcaagtctcacaatgctagcaaagcacgaagattttttgatagtgtcacaaggtctactaagtccctagagccgtggctgtttgcaatccaagcagaggagatgagaaagaagcttgtcgagaatgttcagagagtagatgttggagaaatatattcaacaattcctgaaactgggttaacaaatcggatcaaagctttatttgaacatgcaattcagagtgaaaatggtgcccattgtccattgctgtggagaatgtatttgaactttctgttttctctaggaaataaagaaaggagcaaaggactgttttataaagcccttcagaactgtccctgggcaaaggtgctgtatatggatgcaatagagtattttccagatcaactgcaagagaccctagatctaatgactgaaaaagaattgagagtaagggtacctatagaagaactggaattgctactggaagattaaaaaaaagatggtgcaagaacaacaacaacaaaaaagaaaaagaaaaagcaaacctaaaaaaagggaatgttgacgtccaaaagtctgttttcaactattatctttgactgggacttcaatggactatgcacatatttttcttactaaaaataatttgttaaaaactttgctattcctatgccgcactactagctgtaaatatcttaaaatttgttccacatcttgtagtgggctgctttacacatgtaaatacatctgtttttctggaaagcaaaatccacaaaatgatacttaccgataattaatttgctgttggaccccacctacagttcatatgctacagtttaatacagccgttcccttgaattcagtggaatgtcaagacatgcctactacaatttgctaggcagcacaggaagtaaacatctgccaaatgtaccctttacaatctgctactgtcaacaggctaaatatgtcctgcttggtgtggatgtatatataaatatccacatatgttccagtatcttgctctctgtacaaaacaagaagataagtaaaactcttgaaaaaaattaccagaacaacaattagctcagttgataaactgttaaatgccaaaacttgtttgacaaagtatcagttttgtctttgtatgtgtaataatatgacaattctaatgtaaatatttattaaaacatacttaaatattttaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]