2024-04-26 09:31:52, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_029513745 2805 bp mRNA linear VRT 16-JUN-2019 DEFINITION PREDICTED: Echeneis naucrates protein argonaute-4 (LOC115050728), transcript variant X5, mRNA. ACCESSION XM_029513745 VERSION XM_029513745.1 DBLINK BioProject: PRJNA548465 KEYWORDS RefSeq. SOURCE Echeneis naucrates (live sharksucker) ORGANISM Echeneis naucrates Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Carangaria; Carangiformes; Echeneidae; Echeneis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_042521.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Echeneis naucrates Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2805 /organism="Echeneis naucrates" /mol_type="mRNA" /db_xref="taxon:173247" /chromosome="11" gene 1..2805 /gene="LOC115050728" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins, and 95% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:115050728" CDS 181..2805 /gene="LOC115050728" /codon_start=1 /product="protein argonaute-4 isoform X5" /protein_id="XP_029369605.1" /db_xref="GeneID:115050728" /translation="
MEALGPGPPAPTSLFQPPRRPGLGTVGKPIRLLANHFQVQIPKIDVYHYDIDIKPEKRPRRVNREVVDTMVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDLEVTLPGEGKDQTFKVSLQWVSVVSLQMLLEALSGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPVIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNDMTEVTGRVLPAPMLQYGGRVSTDTGRDCGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKMSYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQDMSQEQLFSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCSDKAERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKDHDSAEGSHVSGQSNGRDPQALAKAVQIHYDTQHTMYFA"
misc_feature 262..651 /gene="LOC115050728" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 682..834 /gene="LOC115050728" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 835..1197 /gene="LOC115050728" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(991..993,1036..1038,1078..1080,1090..1092, 1144..1146,1165..1167,1171..1173) /gene="LOC115050728" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1336..2676 /gene="LOC115050728" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1780..1782,1792..1794,1828..1839,1846..1848, 1870..1872,1879..1881,1891..1893,1903..1905) /gene="LOC115050728" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1984..1986,1990..1992,2230..2232,2644..2646) /gene="LOC115050728" /note="active site" /db_xref="CDD:240015" ORIGIN
cagtagcagcagcggccgtagctccggtcagtcggtccagtcagcagtcctcggcaccaactgtccgtatccccctttttcttaaattagccactttaagtcttcgcgataccgcccccaatttcagcgtcggtacggagccgccaggccgggacagagacggagagagaggcctcggccatggaagcgctcggacccggcccgcctgcccctacctctctgtttcagcctccgcggcgtcccggcctcggcacggtggggaaacccatccggctccttgccaaccacttccaggtgcagattcccaagattgatgtttatcattatgatattgacatcaagcctgagaaacggcctcgaagggtcaacagggaggtggtggacaccatggtgcggcacttcaagatgcagatctttggagaccgacagcctggctacgacgggaagaggaacatgtacacagcacatccactgccaatagggagggacagggtggatttggaggtgaccctgcctggtgaggggaaggatcagacattcaaggtgtccttgcagtgggtgtctgtggtcagtcttcaaatgctgctggaagccctgtccggtcacctgaacgaggtccccgaagactctgtccaggccctggatgtcatcacccggcacctaccctccatgaggtacactccagtggggcgttcatttttctccccgccggagggctactatcatcctctgggtggaggcagggaggtctggtttggtttccatcagtctgtccgtcctgccatgtggaacatgatgctcaatatagatgtgtcggccactgctttctaccgtgcccagcctgtgatagaattcatgtgcgaagtgcttgatatccagaacatcaacgaacagaccaaaccactgacggactcgcagcgcgtcaaattcaccaaggaaataagaggattgaaagttgaggtcacacattgtggtcagatgaagagaaaatatcgagtgtgcaatgtcacacgccgacctgccagccaccaaacgttccccttacagcttgagaatggccaagccatggagtgcacagtagcccagtatttcaagcagaagtacaacctgcagctcaagtatcctcatttgccttgtctacaagtggggcaggaacagaaacacacctaccttcccctggaggtctgtaacattgtagcaggccagcgctgtatcaagaaattgacagacaaccagacatccaccatgattaaagctacagctcgctcagcccccgacagacaagaagagatcagccgactggtcaaaagcaacagcatggtcggggggccagacccttacctgaaggagtttggcattgtggtgcacaatgacatgacggaggttactgggcgtgtgctccctgcgcccatgctgcagtatgggggccgggtgagtacagacacagggagggactgtggcaggaataaaactgtggccacgcccaaccagggcgtgtgggacatgcgcgggaagcagttctatgctggcatcgagatcaaggtctgggctgtggcctgcttcgccccacagaaacagtgtcgggaagacctgctcaagagcttcactgaccagctgcgaaaaatttcaaaggatgctgggatgcccattcaaggccagccatgtttctgtaaatacgcccaaggagctgacagtgtggagccgatgtttaaacacctcaaaatgtcttatgtcgggctgcagctgattgtggtcattctgcccggcaaaacacctgtctatgccgaggtgaagagggtgggcgacactctcctcggcatggccacccagtgtgtccaggtgaagaacgtagtgaagacgtcccctcagactctctccaacctctgcctcaagatcaacgccaaactgggaggcatcaacaacgttcttgtgcctcatcagaggccctctgtgttccagcagccagtcatctttttgggggccgatgtgacgcatcctcctgcaggtgacgggaagaagccatccattgcggcagtggtgggcagcatggatggccaccccagcagatactgcgcaacagtgcgagtccagacatcacgacaagacatgtcccaggagcagctcttcagccaagaggtcatccaagacttgaccaacatggtgcgggaactgctcatccagttctataagtccacacgcttcaagcccactcgtatcatctattaccgcggcggcgtgtcagagggacagatgaagcaggtggcatggccagagctgatagcaatccgcaaggcgtgcatcagtctggaggaggattacaggccgggcattacctacattgtggtccagaagcgtcaccacactcgtctattctgctctgacaaagctgagcgggtggggaagagtggcaatgtcccagccggcaccacagtggacagtaccatcacacacccgtccgagttcgatttctacctgtgcagccatgctggtattcagggaaccagtcgtccctcccactaccacgtcctgtgggatgacaactgcttcacagcagatgaactgcagctcctcacctaccagctgtgccacacctacgtccgctgcactcgctccgtctccatcccagcaccggcctactacgccaggctagtggccttccgagcccgataccacctggtggacaaagaccacgacagcgctgaaggcagccacgtgtcgggacagagtaatggccgggaccctcaggcactggccaaggcagttcagatccactatgatacccagcacaccatgtacttcgcctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]