GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-18 19:15:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_029355589            2594 bp    mRNA    linear   INV 14-OCT-2021
DEFINITION  PREDICTED: Acropora millepora protein argonaute-2-like
            (LOC114975412), mRNA.
ACCESSION   XM_029355589
VERSION     XM_029355589.2
DBLINK      BioProject: PRJNA767661
KEYWORDS    RefSeq.
SOURCE      Acropora millepora
  ORGANISM  Acropora millepora
            Eukaryota; Metazoa; Cnidaria; Anthozoa; Hexacorallia; Scleractinia;
            Astrocoeniina; Acroporidae; Acropora.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_058074.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Oct 14, 2021 this sequence version replaced XM_029355589.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Acropora millepora Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2594
                     /organism="Acropora millepora"
                     /mol_type="mRNA"
                     /isolate="JS-1"
                     /isolation_source="Whole tissue"
                     /db_xref="taxon:45264"
                     /chromosome="9"
                     /tissue_type="Adult tissue"
                     /country="Indonesia"
                     /collection_date="2017"
     gene            1..2594
                     /gene="LOC114975412"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 123 Proteins, and 78% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:114975412"
     CDS             1..2289
                     /gene="LOC114975412"
                     /codon_start=1
                     /product="protein argonaute-2-like"
                     /protein_id="XP_029211422.2"
                     /db_xref="GeneID:114975412"
                     /translation="
MARKSKGRGNRGRGREKNEQDRQQLRKERSENGAAAVVSDLEEKRKLDEEKGEEILWETAGPSERTNTSRNQQSGYTALSTEVKSEEVNATPSARSHDEKPGLSELSLRSSTDHFVKPAGNTEEYIGEGCEVKFGFYQSIRPSQWKVMLVNIDVSAKGFNKSQPVTEFVCETLGLRDLEDRRIKIDREKLKKAISGFRIETTHMAKMRRKYTVWGMSNQSAEKLQFEIIDEASKRTTKTTVAGYFLDTYGIELRYPHLPCLQVGRKRDCYLPMEVCTTIPCQKRHLSEQQTSNMIRSTAHPEPERQKDIQLWAQKMVTGSEGYLKDQFETSIDPPSPLKLGLQDKALTPRDGSWDMSNQALLKSAIVDMWALVCLAPCNEDPLRNFCHQMSSVSNREGMKMTAKPACIKYGERHEEVERLFFDCLEQFPALQLIMVVLPGNDKKLYSEVKRVGDSVIGIPTQCVQVKFVQQAKPQVCANILLKINAKLGGTNHVIDDSFKPAISKDTIVFGADVTHPSPTENGIPSIAAVVASMDYHASKYHARSRVQRHRNGGGAQEIIMDLAEIVKELLIEFIKTNGSRKPSKILLYRDGVSEGQFDQVLVHEVRAVQEACMKLEKDYRPSITFVVLQKRHHTRLFSGKASNVPSGTTVDSGIRHPYEFDFYLCSHHGIQGTSRPTHYNVLYDDNNFTADSLKQLTYQLCHVSARCTRSVSMPAPAYYAHLAASRARVHVTNGNSEFVDLEKCARAIQVNDKMKSEMYFT"
     misc_feature    343..477
                     /gene="LOC114975412"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    484..831
                     /gene="LOC114975412"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(631..633,676..678,721..723,733..735,787..789,
                     805..807,811..813)
                     /gene="LOC114975412"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1000..2193
                     /gene="LOC114975412"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1336..1338,1348..1350,1384..1395,1426..1428,
                     1435..1437,1447..1449,1459..1461)
                     /gene="LOC114975412"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1537..1539,1543..1545,1771..1773,2164..2166)
                     /gene="LOC114975412"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atggcaaggaaatcgaagggaagaggtaatcgtggcagagggagagaaaaaaacgagcaagatcgtcagcaattgcggaaggaaagaagcgaaaatggcgcagctgccgtagtttcggatcttgaagaaaaacgaaaattagacgaagagaaaggcgaagaaatactttgggaaacagctggtccaagcgaacgaacaaataccagtcgaaaccagcaatctggttacactgcactttctacagaagtgaagtctgaagaagtgaatgcaacaccttcagcgcgatcgcatgatgagaagccaggcctgagtgaactgtctctcagatcaagtacagatcattttgtaaaaccagctgggaatacagaggaatatataggggaaggctgtgaggtgaagtttggtttctatcagagtattcgcccctcacaatggaaagtcatgctggtgaacattgatgtgtctgcaaagggatttaataaaagtcaacctgtaacagagtttgtgtgtgaaacactgggtctgcgggatcttgaagacagaagaattaaaattgacagagagaaactcaagaaagctataagcggttttcgtatagaaacaacacatatggcaaaaatgaggaggaagtacacagtttggggaatgtccaaccaatctgctgaaaaattacaatttgaaattatagacgaggcatctaagcgtactaccaaaacaactgtagccgggtactttcttgacacatatggaatagaattaagatatcctcatctaccctgtctccaagttggccggaaaagagactgttaccttcctatggaggtctgtactaccattccttgtcaaaagaggcacttgtctgaacaacaaacctcaaatatgatcaggagtacggcacaccctgagccagagcgacagaaggacattcaactttgggctcaaaaaatggtaacaggaagtgaagggtacttgaaagatcagtttgagacaagcatagacccaccttccccactgaagcttggtcttcaagataaagcactgaccccgcgtgatggctcttgggacatgagcaatcaagccctcttaaaaagcgcaatagtcgatatgtgggcgttagtctgtttggctccttgcaatgaggatccactaagaaacttttgtcatcaaatgtccagtgtgtcaaatcgagaaggaatgaaaatgactgcaaagccagcctgtattaaatatggagaaagacatgaagaagttgagcgattgttctttgactgtttggagcaatttccagcgcttcaactcatcatggttgtcctcccaggaaacgataaaaaactctactcagaagtgaaacgcgttggcgatagcgtaatcggcattccaacacagtgcgtacaggtgaaatttgtgcagcaggcgaaacctcaagtgtgtgctaacatcttgcttaagatcaatgccaagctcggaggaaccaatcacgtcattgatgattcgtttaaaccagcgatcagcaaagatactatcgtgtttggcgccgatgtgacccacccctcccctacagaaaatgggatcccttccattgctgctgtagtggcaagcatggattatcatgcctcgaaatatcacgcccgctcccgcgtgcagaggcacaggaatggcggaggtgcacaagagatcatcatggacctggcagagattgtaaaagagctcctaatcgaatttatcaaaactaatgggtctcgtaagccgtctaagatcttgctttaccgtgatggtgtcagcgaggggcagtttgatcaagttcttgttcacgaagtgcgcgccgtgcaagaagcttgtatgaagcttgagaaagactatcgaccgagcatcacgtttgtcgttctacagaaacgacatcacactagattgttttctggtaaagcaagtaatgtaccatcaggaacaaccgtggacagtggaattaggcatccgtatgaattcgatttctatttgtgtagccaccacggaattcagggaacaagtcgaccaactcattataatgtcttatatgacgacaataacttcactgctgacagcttgaagcagctcacttaccagctgtgtcacgtgtctgccaggtgcacgcggagtgtttctatgccagcccctgcgtattacgctcatttggcagcttcccgggcacgcgtccacgtgaccaatggaaactcagaatttgttgatttggaaaagtgtgcaagggccattcaagtcaatgacaaaatgaaaagtgaaatgtacttcacctgaatagaaaagttaaagattccttggatgggctggaaacaagttaattcacatcttcaacaaattgaagtcaattttttatgtatctgtccttatattaagcattgagcgataaaaaaaaaagaaagaaaaacactaaaatctgcgaaaagctccaaattctatcaattgtcttcaaacttgcgcaataagaattgtcgcacgctcattggttactggtgacagatgtcgaaattccataaagttacgccactatattgtgtaaattaaatttttgtgtctgtcctcttgttgatgataaaaagaag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]