2024-04-18 19:15:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_029355589 2594 bp mRNA linear INV 14-OCT-2021 DEFINITION PREDICTED: Acropora millepora protein argonaute-2-like (LOC114975412), mRNA. ACCESSION XM_029355589 VERSION XM_029355589.2 DBLINK BioProject: PRJNA767661 KEYWORDS RefSeq. SOURCE Acropora millepora ORGANISM Acropora millepora Eukaryota; Metazoa; Cnidaria; Anthozoa; Hexacorallia; Scleractinia; Astrocoeniina; Acroporidae; Acropora. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_058074.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Oct 14, 2021 this sequence version replaced XM_029355589.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Acropora millepora Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2594 /organism="Acropora millepora" /mol_type="mRNA" /isolate="JS-1" /isolation_source="Whole tissue" /db_xref="taxon:45264" /chromosome="9" /tissue_type="Adult tissue" /country="Indonesia" /collection_date="2017" gene 1..2594 /gene="LOC114975412" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 123 Proteins, and 78% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:114975412" CDS 1..2289 /gene="LOC114975412" /codon_start=1 /product="protein argonaute-2-like" /protein_id="XP_029211422.2" /db_xref="GeneID:114975412" /translation="
MARKSKGRGNRGRGREKNEQDRQQLRKERSENGAAAVVSDLEEKRKLDEEKGEEILWETAGPSERTNTSRNQQSGYTALSTEVKSEEVNATPSARSHDEKPGLSELSLRSSTDHFVKPAGNTEEYIGEGCEVKFGFYQSIRPSQWKVMLVNIDVSAKGFNKSQPVTEFVCETLGLRDLEDRRIKIDREKLKKAISGFRIETTHMAKMRRKYTVWGMSNQSAEKLQFEIIDEASKRTTKTTVAGYFLDTYGIELRYPHLPCLQVGRKRDCYLPMEVCTTIPCQKRHLSEQQTSNMIRSTAHPEPERQKDIQLWAQKMVTGSEGYLKDQFETSIDPPSPLKLGLQDKALTPRDGSWDMSNQALLKSAIVDMWALVCLAPCNEDPLRNFCHQMSSVSNREGMKMTAKPACIKYGERHEEVERLFFDCLEQFPALQLIMVVLPGNDKKLYSEVKRVGDSVIGIPTQCVQVKFVQQAKPQVCANILLKINAKLGGTNHVIDDSFKPAISKDTIVFGADVTHPSPTENGIPSIAAVVASMDYHASKYHARSRVQRHRNGGGAQEIIMDLAEIVKELLIEFIKTNGSRKPSKILLYRDGVSEGQFDQVLVHEVRAVQEACMKLEKDYRPSITFVVLQKRHHTRLFSGKASNVPSGTTVDSGIRHPYEFDFYLCSHHGIQGTSRPTHYNVLYDDNNFTADSLKQLTYQLCHVSARCTRSVSMPAPAYYAHLAASRARVHVTNGNSEFVDLEKCARAIQVNDKMKSEMYFT"
misc_feature 343..477 /gene="LOC114975412" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 484..831 /gene="LOC114975412" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(631..633,676..678,721..723,733..735,787..789, 805..807,811..813) /gene="LOC114975412" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1000..2193 /gene="LOC114975412" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1336..1338,1348..1350,1384..1395,1426..1428, 1435..1437,1447..1449,1459..1461) /gene="LOC114975412" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1537..1539,1543..1545,1771..1773,2164..2166) /gene="LOC114975412" /note="active site" /db_xref="CDD:240015" ORIGIN
atggcaaggaaatcgaagggaagaggtaatcgtggcagagggagagaaaaaaacgagcaagatcgtcagcaattgcggaaggaaagaagcgaaaatggcgcagctgccgtagtttcggatcttgaagaaaaacgaaaattagacgaagagaaaggcgaagaaatactttgggaaacagctggtccaagcgaacgaacaaataccagtcgaaaccagcaatctggttacactgcactttctacagaagtgaagtctgaagaagtgaatgcaacaccttcagcgcgatcgcatgatgagaagccaggcctgagtgaactgtctctcagatcaagtacagatcattttgtaaaaccagctgggaatacagaggaatatataggggaaggctgtgaggtgaagtttggtttctatcagagtattcgcccctcacaatggaaagtcatgctggtgaacattgatgtgtctgcaaagggatttaataaaagtcaacctgtaacagagtttgtgtgtgaaacactgggtctgcgggatcttgaagacagaagaattaaaattgacagagagaaactcaagaaagctataagcggttttcgtatagaaacaacacatatggcaaaaatgaggaggaagtacacagtttggggaatgtccaaccaatctgctgaaaaattacaatttgaaattatagacgaggcatctaagcgtactaccaaaacaactgtagccgggtactttcttgacacatatggaatagaattaagatatcctcatctaccctgtctccaagttggccggaaaagagactgttaccttcctatggaggtctgtactaccattccttgtcaaaagaggcacttgtctgaacaacaaacctcaaatatgatcaggagtacggcacaccctgagccagagcgacagaaggacattcaactttgggctcaaaaaatggtaacaggaagtgaagggtacttgaaagatcagtttgagacaagcatagacccaccttccccactgaagcttggtcttcaagataaagcactgaccccgcgtgatggctcttgggacatgagcaatcaagccctcttaaaaagcgcaatagtcgatatgtgggcgttagtctgtttggctccttgcaatgaggatccactaagaaacttttgtcatcaaatgtccagtgtgtcaaatcgagaaggaatgaaaatgactgcaaagccagcctgtattaaatatggagaaagacatgaagaagttgagcgattgttctttgactgtttggagcaatttccagcgcttcaactcatcatggttgtcctcccaggaaacgataaaaaactctactcagaagtgaaacgcgttggcgatagcgtaatcggcattccaacacagtgcgtacaggtgaaatttgtgcagcaggcgaaacctcaagtgtgtgctaacatcttgcttaagatcaatgccaagctcggaggaaccaatcacgtcattgatgattcgtttaaaccagcgatcagcaaagatactatcgtgtttggcgccgatgtgacccacccctcccctacagaaaatgggatcccttccattgctgctgtagtggcaagcatggattatcatgcctcgaaatatcacgcccgctcccgcgtgcagaggcacaggaatggcggaggtgcacaagagatcatcatggacctggcagagattgtaaaagagctcctaatcgaatttatcaaaactaatgggtctcgtaagccgtctaagatcttgctttaccgtgatggtgtcagcgaggggcagtttgatcaagttcttgttcacgaagtgcgcgccgtgcaagaagcttgtatgaagcttgagaaagactatcgaccgagcatcacgtttgtcgttctacagaaacgacatcacactagattgttttctggtaaagcaagtaatgtaccatcaggaacaaccgtggacagtggaattaggcatccgtatgaattcgatttctatttgtgtagccaccacggaattcagggaacaagtcgaccaactcattataatgtcttatatgacgacaataacttcactgctgacagcttgaagcagctcacttaccagctgtgtcacgtgtctgccaggtgcacgcggagtgtttctatgccagcccctgcgtattacgctcatttggcagcttcccgggcacgcgtccacgtgaccaatggaaactcagaatttgttgatttggaaaagtgtgcaagggccattcaagtcaatgacaaaatgaaaagtgaaatgtacttcacctgaatagaaaagttaaagattccttggatgggctggaaacaagttaattcacatcttcaacaaattgaagtcaattttttatgtatctgtccttatattaagcattgagcgataaaaaaaaaagaaagaaaaacactaaaatctgcgaaaagctccaaattctatcaattgtcttcaaacttgcgcaataagaattgtcgcacgctcattggttactggtgacagatgtcgaaattccataaagttacgccactatattgtgtaaattaaatttttgtgtctgtcctcttgttgatgataaaaagaag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]