2025-07-16 05:38:48, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_028352510 573 bp mRNA linear PLN 12-MAR-2019 DEFINITION PREDICTED: Glycine soja uncharacterized LOC114391506 (LOC114391506), mRNA. ACCESSION XM_028352510 VERSION XM_028352510.1 DBLINK BioProject: PRJNA525136 KEYWORDS RefSeq; includes ab initio. SOURCE Glycine soja ORGANISM Glycine soja Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50 kb inversion clade; NPAAA clade; indigoferoid/millettioid clade; Phaseoleae; Glycine; Glycine subgen. Soja. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_041018.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Glycine soja Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 100% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..573 /organism="Glycine soja" /mol_type="mRNA" /cultivar="W05" /db_xref="taxon:3848" /chromosome="17" /tissue_type="hypocotyl of etiolated seedlings" /dev_stage="Seedlings" /geo_loc_name="China: Henan" gene 1..573 /gene="LOC114391506" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein" /db_xref="GeneID:114391506" CDS 1..573 /gene="LOC114391506" /codon_start=1 /product="uncharacterized protein LOC114391506" /protein_id="XP_028208311.1" /db_xref="GeneID:114391506" /translation="
MDPIKYILEKLALIGWIAWWQVLPSEFDIVYVTQKAIKGSALADYLAQQPINDYQPMHPEFLDEVIMTFFKGEVEDKDRDKWIMLGFECTNNIAEYKACALGIQATIHFKVKLLKVYIRKLIGFFDDISFHHIPREENQMANALATLASMFQLTSHRDLPYIKFRCCGKPTHCCLIEEEQDGKPWYFDIK"
misc_feature <253..447 /gene="LOC114391506" /note="Ribonuclease H-like superfamily, including RNase H, HI, HII, HIII, and RNase-like domain IV of spliceosomal protein Prp8; Region: RNase_H_like; cl14782" /db_xref="CDD:449355" ORIGIN
atggacccaatcaagtacatcttagaaaaacttgctctcattggatggatcgcttggtggcaggttctaccatcggaatttgacattgtttatgtcactcaaaaggcgataaaggggagtgccttggcagattacctggctcaacagcccatcaatgactaccagcctatgcatccagaattccttgatgaggtcatcatgaccttctttaagggggaagtagaggataaagatagggacaaatggattatgttgggttttgaatgcacaaacaacatagccgagtataaggcgtgcgcccttgggatccaagcaacaattcacttcaaggtcaagttgctcaaggtctacatcaggaagttgataggattctttgatgacatatcctttcatcacattcctagagaggagaatcagatggccaatgcccttgccactctagcatccatgttccaactaacctcgcatagggatttgccgtacatcaaattcagatgttgtggcaagcctacacattgttgcttgatagaagaagagcaagatggtaaaccttggtacttcgatatcaaatga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]