GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-16 05:38:48, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_028352510             573 bp    mRNA    linear   PLN 12-MAR-2019
DEFINITION  PREDICTED: Glycine soja uncharacterized LOC114391506
            (LOC114391506), mRNA.
ACCESSION   XM_028352510
VERSION     XM_028352510.1
DBLINK      BioProject: PRJNA525136
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Glycine soja
  ORGANISM  Glycine soja
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50
            kb inversion clade; NPAAA clade; indigoferoid/millettioid clade;
            Phaseoleae; Glycine; Glycine subgen. Soja.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_041018.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Glycine soja Annotation Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..573
                     /organism="Glycine soja"
                     /mol_type="mRNA"
                     /cultivar="W05"
                     /db_xref="taxon:3848"
                     /chromosome="17"
                     /tissue_type="hypocotyl of etiolated seedlings"
                     /dev_stage="Seedlings"
                     /geo_loc_name="China: Henan"
     gene            1..573
                     /gene="LOC114391506"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein"
                     /db_xref="GeneID:114391506"
     CDS             1..573
                     /gene="LOC114391506"
                     /codon_start=1
                     /product="uncharacterized protein LOC114391506"
                     /protein_id="XP_028208311.1"
                     /db_xref="GeneID:114391506"
                     /translation="
MDPIKYILEKLALIGWIAWWQVLPSEFDIVYVTQKAIKGSALADYLAQQPINDYQPMHPEFLDEVIMTFFKGEVEDKDRDKWIMLGFECTNNIAEYKACALGIQATIHFKVKLLKVYIRKLIGFFDDISFHHIPREENQMANALATLASMFQLTSHRDLPYIKFRCCGKPTHCCLIEEEQDGKPWYFDIK"
     misc_feature    <253..447
                     /gene="LOC114391506"
                     /note="Ribonuclease H-like superfamily, including RNase H,
                     HI, HII, HIII, and RNase-like domain IV of spliceosomal
                     protein Prp8; Region: RNase_H_like; cl14782"
                     /db_xref="CDD:449355"
ORIGIN      
atggacccaatcaagtacatcttagaaaaacttgctctcattggatggatcgcttggtggcaggttctaccatcggaatttgacattgtttatgtcactcaaaaggcgataaaggggagtgccttggcagattacctggctcaacagcccatcaatgactaccagcctatgcatccagaattccttgatgaggtcatcatgaccttctttaagggggaagtagaggataaagatagggacaaatggattatgttgggttttgaatgcacaaacaacatagccgagtataaggcgtgcgcccttgggatccaagcaacaattcacttcaaggtcaagttgctcaaggtctacatcaggaagttgataggattctttgatgacatatcctttcatcacattcctagagaggagaatcagatggccaatgcccttgccactctagcatccatgttccaactaacctcgcatagggatttgccgtacatcaaattcagatgttgtggcaagcctacacattgttgcttgatagaagaagagcaagatggtaaaccttggtacttcgatatcaaatga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]