GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-12-05 23:20:32, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XM_027937397            4417 bp    mRNA    linear   ROD 21-MAY-2020
DEFINITION  PREDICTED: Marmota flaviventris protein argonaute-4 (LOC114094297),
            mRNA.
ACCESSION   XM_027937397
VERSION     XM_027937397.1
DBLINK      BioProject: PRJNA516936
KEYWORDS    RefSeq.
SOURCE      Marmota flaviventris (yellow-bellied marmot)
  ORGANISM  Marmota flaviventris
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Sciuromorpha; Sciuridae; Xerinae; Marmotini; Marmota.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_023144676.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Marmota flaviventris Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4417
                     /organism="Marmota flaviventris"
                     /mol_type="mRNA"
                     /isolate="SJ_83"
                     /db_xref="taxon:93162"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..4417
                     /gene="LOC114094297"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 mRNAs, 30 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments"
                     /db_xref="GeneID:114094297"
     CDS             29..2614
                     /gene="LOC114094297"
                     /codon_start=1
                     /product="protein argonaute-4"
                     /protein_id="XP_027793198.1"
                     /db_xref="GeneID:114094297"
                     /translation="
MEALGPGPPTSLFQPPRRPGLGTVGKPIRLLANHFQVQIPKIDVYHYDVDIKPEKRPRRVNREVVDTMVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDMEVTLPGEGKDQTFKVSVQWVSVVSLQLLLEALAGHLNEVPDDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPIIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYSLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNEMTELTGRVLPAPMLQYGGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKMTYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQEISQELLYSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCADKTERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYQVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKDHDSAEGSHVSGQSNGRDPQALAKAVQIHHDTQHTMYFA"
     misc_feature    104..493
                     /gene="LOC114094297"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:374571"
     misc_feature    524..676
                     /gene="LOC114094297"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:370073"
     misc_feature    677..1039
                     /gene="LOC114094297"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(833..835,878..880,920..922,932..934,986..988,
                     1007..1009,1013..1015)
                     /gene="LOC114094297"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1178..2485
                     /gene="LOC114094297"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1589..1591,1601..1603,1637..1648,1655..1657,
                     1679..1681,1688..1690,1700..1702,1712..1714)
                     /gene="LOC114094297"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(1793..1795,1799..1801,2039..2041,2453..2455)
                     /gene="LOC114094297"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
ccggggcgaggcggcccccgccgccgccatggaggcgctgggacccggacctccaactagcctctttcagccacctcgtcgtccgggccttggaactgttggaaaaccaattcgactgttagctaatcattttcaggttcagatccctaaaatagatgtgtatcactatgatgtggatattaaaccagaaaaacggcctcgtagagtcaacagggaggtagtagatacaatggtgagacacttcaagatgcagatatttggtgatcggcagcctggctatgatggcaaaagaaacatgtacacagcacatccactgccaattggacgggatagggttgatatggaagtgaccctcccaggtgagggtaaagaccaaaccttcaaagtgtctgttcaatgggtgtctgttgtgagccttcagttgcttttagaagctttagctgggcacttgaatgaagtcccagatgactcagtacaagcacttgatgttatcacaagacatcttccctctatgaggtacactccggtgggtcgttccttcttctcacctcctgaaggttactaccaccctctgggagggggcagagaggtttggtttggtttccatcagtctgtaagacctgctatgtggaacatgatgctcaacattgatgtatctgcaactgctttctacagggctcagcctattattgagttcatgtgtgaggttttagacattcagaacatcaatgaacagaccaaacctctaacagactcccagcgtgtcaagtttaccaaagaaatcagaggtctcaaagttgaagtgactcactgtggacagatgaaacgaaaatatcgagtttgtaatgtgactagacgaccagccagtcatcaaacttttcctttgcagctagaaaatggtcaagcaatggaatgtacagtagctcaatattttaagcaaaagtatagtctacagctgaaatatccccatcttccctgtctccaagtgggacaagaacaaaagcatacatacttgccacttgaggtctgtaacatagtggcaggacagcgatgtataaagaaactcacagacaatcagacttccacgatgatcaaagccacagcaagatctgctcctgacagacaggaagagatcagtagactggtgaagagtaacagtatggtgggtggacctgatccttacctgaaagaatttgggattgttgtgcacaatgaaatgacagagctcacaggcagggtgcttccagcaccaatgctgcaatatggaggccggaataaaacagtagccacacccaaccagggtgtctgggacatgcgaggaaagcagttttatgctggcattgaaattaaagtttgggcagttgcttgttttgcgcctcagaaacaatgtagggaagatttactaaaaagtttcactgaccaactgcgtaaaatctccaaggatgcaggaatgcccatccagggtcagccatgtttctgcaagtacgcacaaggtgcagacagcgtggagcccatgtttaaacatctgaaaatgacatatgtgggcctacagctgatagtggttatcttgccgggaaagacaccagtatatgcggaggtaaaacgtgttggagatacccttctaggtatggccacacagtgtgtccaggtaaaaaacgtagtgaagacctcaccccaaaccctttccaatctttgcctgaagataaatgcaaagcttggaggaattaacaatgtacttgtacctcatcaaaggccctccgtgttccagcaacctgtcatcttcctgggagcagatgtcactcaccctccagcgggagatgggaagaagccctccatagcggccgtggtgggcagtatggatggccaccccagcaggtattgcgccacggttcgggtgcagacttcccggcaggagatctcccaagaactcctctacagtcaggaggtcatccaggacctcactaacatggttcgagaacttctgatccagttctacaaatccacgcgcttcaaacccactcgcatcatctattaccgtggaggggtatctgagggacaaatgaaacaggtagcttggccggaattaatagcgattcgaaaggcatgtatcagtttggaggaagattatcggccaggaataacatatattgtggtgcaaaagagacatcacacaagactgttctgtgcagataaaacagaaagggtggggaaaagtggcaatgtaccagcaggcactacggtggatagtaccatcacacatccatctgagtttgacttttacctttgtagtcatgcaggaattcagggaaccagccgcccttcacattaccaggtcttgtgggatgacaactgcttcactgcagatgagctccagctactgacttatcagctgtgtcacacctatgtgaggtgcacacgctcagtctctattccagcccctgcatattatgcccggcttgtagcatttagggcaaggtatcatctggtggataaagatcatgacagcgcggaaggcagtcatgtgtcaggacaaagcaacggccgggatcctcaggccttggctaaggctgtgcagattcaccatgatacccagcacacaatgtattttgcctgagagtctcagaaaaaaagaactcaaccagtttggtaccccatacagcctcaaaatgtttcaaatgcctaccgcctctagatagagccaagttgacttcagttggtcttctaccagcagctcggaatagttgcactgaatctatactttgcagcactgtctgatgcatcaacaaattgagccatttttttaaagtaatagatactcatagattatcttttctgatgcactggacagaatttttacctcaatgtgcaaaggctgatcagcctgaactttctaaaggactttacaagaaaggtttctatggaatattttgctagctgtggtgttcaccgcatccctctagtcttataagagaagattattcctttttttctgtgtttattgagtggggtgtatgcataagtgggaaagaaaaaccaaaccaactacttcagttcagtgtaactaattggatgagcccatagactttttaatggagatttctgactttaccactgtaaatgcctttaacgagcattaatttttgaaagttttacagagttttattagttttactactttgtcttattgatctctgcagacttgtgctggtgcaagtatagactgctaggcaattgcactatatttggctgcagattcaaataggcacttctcttattcagttgactttaatgaatgtgtgacataaacagatgaaatgcatgtcacagtgacagataatactgccatggaaaaagtacatgtttctccctgtttgaaaaaaaaattagcttttagtatttttccaagttttcaaaagtgcccattttatgctgctgcggtgtgatttgttagatctaaatgatttttaaacttttctcatagaaagttaactttggcaataaacattttttaaggtccctcctcttcttcccccaatgatgtagttttctagatgagatttcggtatgattttatcagctatttcttatatatcataatctggcaatttctgaaaccagtcagaaaagacatatatttccatgccttttgaaagaattgttttttacttgttttatagtcacaatcggtgtcctgtcattttgttctaaaataagctagaaccaggatgcttccttattggatagggtttgccagtgatgttgcacttgcaaaaaatgtaccagcattgaacattttttcctgggaatcaagtttatttacataattacttgcagtgcattttttttcctttttctttctctttcaacctgaaatgtacttgggttttccttccttttattcaactaaaactgtgtagaaaaggttgatttttctgaagattctggaacccactcacagggagacaggattcctttcttgcccaaaaaagggagttgatctaaagcaagcatcaattaaaatgtaagggaaaatatattctgtatttagtgtagataatactttgtaatggacgacagttacatagagtcttgttagttccagccagtgtttcccagcccacattttactgattgatttattctccatcctggaaccaccggagtgagagattaagggccctcgaggagccatactccattggctgaggaagatgctgggggaagagacagacacaatgtggtgaaaacaattttgccgcttgtctggaaactgctggtgggaaacactggatcagatggtgaaggatgtttgcttgaactcattagttggtccaaatctcttaaactggccttctcaaaatcccagcaatataaagcactgtttttcttcagtcttttaaacaagcttgtaaataca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]