GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-15 04:23:40, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_026987349            3016 bp    mRNA    linear   INV 07-NOV-2018
DEFINITION  PREDICTED: Drosophila persimilis putative leucine-rich
            repeat-containing protein DDB_G0290503 (LOC6593906), mRNA.
ACCESSION   XM_026987349
VERSION     XM_026987349.1
DBLINK      BioProject: PRJNA501994
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Drosophila persimilis
  ORGANISM  Drosophila persimilis
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Diptera; Brachycera;
            Muscomorpha; Ephydroidea; Drosophilidae; Drosophila; Sophophora.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_020825294.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Drosophila persimilis Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 4% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..3016
                     /organism="Drosophila persimilis"
                     /mol_type="mRNA"
                     /strain="14011-0111.01,24,50"
                     /db_xref="taxon:7234"
                     /chromosome="Unknown"
                     /tissue_type="whole body"
                     /dev_stage="adult"
     gene            1..3016
                     /gene="LOC6593906"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 95% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:6593906"
     CDS             1..2883
                     /gene="LOC6593906"
                     /codon_start=1
                     /product="putative leucine-rich repeat-containing protein
                     DDB_G0290503"
                     /protein_id="XP_026843150.1"
                     /db_xref="GeneID:6593906"
                     /translation="
MNYGKYLFFVMLVLIPLAIDSLADIGVDQESCFMASDLEDQCGFVCYPIVKPLLQYLARCQEKDSQINQLEEEVRELRVESVKCKSETEALGKQLRNNFCDQKSVLKQALENVQKVQFQLSSELRYLQEDTRHQQTERVDAAVVRKLKIELSSKESLLTDVKSKLIQKYEILEQKEKSIKEKDKLLAEKDEYIKQMMEKYLPRSCETFEGTKGVRTIYVPATEPFSVLCNSIIDGSGWAIVLRELEGSASLDHKLNQYKEKGFGDLHDSFFIGRKNLYLMTREMPHEVFVMLKFLDGSIEVYKGTKVYMGDEEEDYVIKSFNTIPRIGDYSVQQTATSVSLDALFRKQFLPFDDLPEWKELTIMIRETLNIKVYSQNMLNIFIIVLVFFNLSENLTRGSDFHENQESCFVSRELEDQCAAVCYPTVKPLLKYMGICHQKDLHISGMQNQLQDQNEKVTKYKTQVEFLNKKLVDERSSSGLKNDLKETIDKVQNLRLELSEELKKLYRQKNNTVKNQHEEIANVKMQLKRKDEQNEKTMIEKDEIIKQKEKTMEEKDELLKQKKKIMEEKDELLKKKDNTLKNLQEEIANVKMQLKRKDEQNEKTMIEKDEIIKQKEKTMEEKDELLKQKKKIMEEKDELLKKKDNTLKNLQEEIANVKMQLKRKDEQNEKTMIEKDEIIKQKEKTMEEKDELLKQKKKIMEEKDELLKKKDNTLKNLQEEIANVKMQLKRKDEQNEKTMIEKDEIIKQKDKTMEEKDELLKKKDSTLKNLQKEIANVKIQLTSKDELLEQKEEQIKKKDQFIRHILDNADPKISETHTIDVPLAEPDESGWTIILQELEGLASLEKKLAQYKEKPFNNGNDSFFIGRKNLYFMAKATPHEILIQVKFVDGRSSSVQDIRFKVGNAEADYTLRSVNDNLPNRKYSITEMKALMAIQVLMKRKMPFSSRDWKQLTIKFREIQ"
     misc_feature    601..>993
                     /gene="LOC6593906"
                     /note="Fibrinogen-related domains (FReDs); C terminal
                     globular domain of fibrinogen. Fibrinogen is involved in
                     blood clotting, being activated by thrombin to assemble
                     into fibrin clots. The N-termini of 2 times 3 chains come
                     together to form a globular...; Region: FReD; cl00085"
                     /db_xref="CDD:412152"
     misc_feature    949..951
                     /gene="LOC6593906"
                     /note="gamma-gamma dimer interface [polypeptide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    1369..>2427
                     /gene="LOC6593906"
                     /note="chromosome segregation protein SMC, common
                     bacterial type; Region: SMC_prok_B; TIGR02168"
                     /db_xref="CDD:274008"
     misc_feature    2473..>2844
                     /gene="LOC6593906"
                     /note="Fibrinogen-related domains (FReDs); C terminal
                     globular domain of fibrinogen. Fibrinogen is involved in
                     blood clotting, being activated by thrombin to assemble
                     into fibrin clots. The N-termini of 2 times 3 chains come
                     together to form a globular...; Region: FReD; cl00085"
                     /db_xref="CDD:412152"
     misc_feature    2728..2730
                     /gene="LOC6593906"
                     /note="gamma-gamma dimer interface [polypeptide binding];
                     other site"
                     /db_xref="CDD:238039"
ORIGIN      
atgaattacgggaaatatctcttctttgttatgcttgttctgatccctttggctattgattctctggcggacatcggagtggatcaagagtcttgtttcatggcaagcgatctggaagatcagtgcggtttcgtttgctatcccattgttaagcccctgcttcagtatttggccaggtgtcaggagaaggattcgcaaattaaccaacttgaggaagaggtgcgagagctaagagttgaaagcgtcaaatgtaagagtgaaacggaggcgctcggtaaacaattgagaaacaacttttgtgaccagaaaagtgtactaaagcaagccctcgaaaatgtccaaaaggtgcagtttcaactcagttccgagcttaggtatctccaagaagacaccagacaccagcaaacggaacgagtcgatgcagcagttgtgcggaaactgaagattgaattgtcgagcaaggagtcattattaactgatgtcaaatccaaattaatacaaaagtatgaaatattagagcaaaaggagaaatcaataaaggaaaaggataagctattggcagagaaggatgaatatatcaagcagatgatggagaagtaccttccgcgaagctgtgagacctttgaaggcaccaaaggggtccgaacgatctatgttcctgcgacagaaccgttctcggtgctttgtaactcgattatcgatggatctggttgggcaatcgttttgcgagaacttgagggatctgctagcctagaccacaagctaaatcaatataaagaaaaggggttcggagatctgcacgactcatttttcatcggtcgaaagaacctgtatctcatgacacgagaaatgccacacgaagtttttgtcatgttgaaatttctagacggttctattgaagtttataaaggcacaaaagtgtacatgggcgacgaagaggaagactacgttatcaagtcgttcaatacaattccaagaatcggagactactccgtccaacaaacggcaacgtcagtgtcactcgacgctctgttcaggaaacaatttttgccattcgatgatcttcctgaatggaaagaattgaccattatgatcagagagaccttaaatatcaaggtatattcccagaatatgttgaatatttttattattgtgttggttttttttaatttgtcggagaatttgacacgtggttcagatttccatgaaaaccaagagtcttgttttgtatcaagagaactggaagatcaatgcgctgccgtttgttatcccaccgtcaagccgttgcttaaatacatgggaatatgccatcagaaggatctacatataagtggaatgcagaaccaacttcaagaccaaaatgagaaggttaccaaatacaaaactcaagtagaatttctcaataaaaagttggtagacgagcgaagttcttctggcctcaagaatgacctaaaagaaaccatcgataaggtgcagaacctcagattggagctcagtgaagagttgaaaaagttatacagacagaaaaacaataccgtgaagaatcagcacgaagaaatcgcgaatgtgaagatgcaactgaagagaaaggatgaacaaaacgagaaaacgatgatagaaaaggatgaaattataaaacaaaaggagaaaacgatggaagaaaaggatgaactcttaaaacagaagaagaaaattatggaagaaaaagatgaactattaaaaaagaaggacaataccttgaagaatctgcaagaagaaatcgcgaatgtgaagatgcaactgaagagaaaggatgaacaaaacgagaaaacgatgatagaaaaggatgaaattataaaacaaaaggagaaaacgatggaagaaaaggatgaactcttaaaacagaagaagaaaattatggaagaaaaagatgaactattaaaaaagaaggacaataccttgaagaatctgcaagaagaaatcgcgaatgtgaagatgcaactgaagagaaaggatgaacaaaacgagaaaacgatgatagaaaaggatgaaattataaaacaaaaggagaaaacgatggaagaaaaggatgaactcttaaaacagaagaagaaaattatggaagaaaaagatgaactattaaaaaagaaggacaataccttgaagaatctgcaagaagaaatcgcgaatgtgaagatgcaactgaagagaaaggatgaacaaaacgagaaaacgatgatagaaaaggatgaaattataaaacaaaaggataaaacgatggaagaaaaggatgaactcttaaaaaagaaggatagtaccttgaagaatctgcaaaaagaaatcgcgaatgtgaagatacaactgacgagcaaggatgaattattagaacaaaaggaggaacaaattaaaaaaaaggatcagtttattaggcatattttggataatgcagacccaaaaattagcgagactcatacaatcgatgttcctttggcagaaccagacgaaagtggttggacaattattttgcaagaacttgagggattggctagtctagaaaagaagcttgctcaatataaagaaaagccgttcaacaatggaaatgattcatttttcatcggccgcaagaatctgtatttcatggcaaaggccacgccacacgaaattcttatccaagtgaaatttgtggatggcagaagctcttcggttcaagacattcgcttcaaagtgggcaacgcagaagcagactacacactcaggtcggtcaatgataatttaccaaacagaaagtactccattaccgaaatgaaagcgcttatggcgattcaggttcttatgaaacgaaaaatgccattcagttctagggactggaagcaattgaccattaagttcagagagatccaataatagaagaaggaaccattatgcgcccttgatagagaagtatttttatatatttaaatacaatttttgaattcttcggtaatcgatgaagctaccgtgaactaacgttaaaaaaatagcttaaaaaataaaagtt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]