GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 00:56:56, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XM_026301804            3928 bp    mRNA    linear   VRT 10-APR-2020
DEFINITION  PREDICTED: Mastacembelus armatus NRDE-2, necessary for RNA
            interference, domain containing (nrde2), transcript variant X1,
            mRNA.
ACCESSION   XM_026301804
VERSION     XM_026301804.1
DBLINK      BioProject: PRJNA489256
KEYWORDS    RefSeq.
SOURCE      Mastacembelus armatus (zig-zag eel)
  ORGANISM  Mastacembelus armatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Anabantaria; Synbranchiformes; Mastacembelidae;
            Mastacembelus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_046654.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Mastacembelus armatus Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3928
                     /organism="Mastacembelus armatus"
                     /mol_type="mRNA"
                     /db_xref="taxon:205130"
                     /chromosome="22"
     gene            1..3928
                     /gene="nrde2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 5 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 6 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:113127328"
     CDS             53..3658
                     /gene="nrde2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2 isoform X1"
                     /protein_id="XP_026157589.1"
                     /db_xref="GeneID:113127328"
                     /translation="
MRHIIMALFPAFAGLADNKVDDPSEELDWLNNKSFQARDALSLHSRFIEEKESSVGREVGSAEEEKEGEDNVPLKKKKKKSEKKRKKKKKHKKKSGRDSDSGGSDSDTIYPSDLKKEHEADRTQAAPLASRFSWLDDLHLPLEQPFCVDHKPDPANWTYKSLYRGDVARYKRKGSSSLGLDRRRQEVSWEESESRKKQKDKKKTADRYFSAVSRQLLRSEIPVPTLPVIPECGDVIKYPSFLQLSEDAEKKGGEAGDKVQMSWVNPLGVYDPSTALWLQGKGQDKQKEDLQAGQSAVLLAGRTEEFNRRLREQPADTQLWIQFIQYQDELTSAMFGGEEEQQGNDSTEWRKSSYRAVLEKKLSIAERAVATNPGSVALQLERLRICQELWEPSVLAKEWKKLVFLHPNSTSLWRAYLLFTQSYFSNFTVSKVNSAYGKCLSTLSAVRDGTMVSHPALPGIEEDMLDIFTQQCHFLRQSGHTEKAISLFQAMMDFTFYKPDSVRELSTKQQVEFFEPFWDSGEARVGELGARGWKAWMVQQERGGWLQPSAEEEEEEEDEEEEVKDRRQPRWTVWLDVESSREAAQWLPWRPDKSKGQSEEDCEDPDRQVLFDDIGPSLICLSSPELQLQLLLHFMSFLGLPVDSALFAAPSQPGLLLENLSLLTQGIDPLRPLTSHDLPDTGLNAVGHMTTLQGTKKWAGLGKQGETFITNVFNMVQAVLPVHHQAILSLSWIQYEKLKVLRCLRSGNKKRLRSQGKSSKRVAKRLLKESNNRSSLVLWREYAHLEWMLGNVDEARKVFSTATAMGGTKGLSSPSLCDLCLLWAQLEVENGVAVRGADLTDVTASPAVTVLTKLAEGTSTFSSSSDPLSPVSVLKARRSYEQILTASLAALDKDPNNSQTNIKGQEHLLEEKLRLKGLVGCYALFQYLTVGIQAANAVYSQARERIEEQYHTLTLDKQPNSNEGANLASTDSSNSAADSCYTSRNYMKRLASECEVLAVQQAALLRYHNSVSVFPLATLRQTLTSTLSTWCSSAPLWSIYVQVEDRYHSAGRARRFFHSVTRHTDSVVPRLFAIVVEQQRKQLVDAAQKSCCHDAALPILPENGLSNRIRGLFETAIATEIGAHCPLVWRMYMHFLVSEGKVDKATGIFYRALQNIPWAKGLYMDAVQLFPEHLQEFVDLMTEKELRLRLPLEELDILLED"
     misc_feature    965..1789
                     /gene="nrde2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:312057"
ORIGIN      
ttttttgttttttagcttaaactgacgacgtcatcttcccgcgactgtttttatgcgacatatcatcatggcgctgtttccagcttttgctggattagcagacaacaaagttgacgatccgtccgaagaattagactggctgaacaataagagctttcaggccagggacgccctctctcttcacagtcggtttatagaggaaaaggaatcaagtgtaggtagagaggtgggctctgcggaggaagagaaggaaggagaggacaatgtgccactcaaaaagaagaaaaagaaaagtgaaaagaaacgaaaaaagaagaaaaaacataaaaagaagagtggaagggattcggacagtggtgggtctgactctgacaccatctaccccagtgacctcaaaaaggaacatgaggcagataggacccaggccgctcccttagcaagtcgtttctcctggttggatgacctccacctgcccctggagcagccgttctgtgtggaccataaacctgatccagccaactggacatacaagtcactgtacagaggagacgtagcaaggtacaagaggaaaggcagctcctcactgggtctggaccgtcgcaggcaggaagtcagttgggaggaatcagaatcaagaaagaaacagaaagacaaaaagaaaacagcagacagatacttctctgcagtcagtcggcagctgctgaggtctgagattcctgttcctactttaccagtgatccctgagtgtggtgatgtcattaaatacccatcattcctccaattgagtgaggatgcggaaaagaaaggaggagaggcaggtgacaaagtgcagatgtcatgggtaaatcctctcggtgtgtacgacccctccacagccctttggctgcagggcaaaggacaggacaagcagaaggaggacctacaggctgggcagagtgctgtgctgttggccggcaggactgaagagtttaacagacggctgagagagcagccagcagacacacagctgtggatacagtttatacagtatcaggatgagctgacttcagccatgtttggaggggaggaggaacagcagggcaatgattcaactgagtggcgcaagtcttcctaccgagcggttctagagaaaaagctgagcatcgctgagcgtgctgtggccaccaaccctggctccgtagctctgcagctggagagactcaggatctgccaggagctctgggagccctcagttctggctaaagagtggaagaaattggtgttcctccacccaaacagcacctccctgtggagggcgtatctgcttttcacccagagctacttcagcaacttcactgtgtcaaaagtcaactctgcctatgggaagtgtctgagcacgctcagtgctgtgagggatggcaccatggtctctcaccccgcgttaccagggattgaggaggacatgttggatatcttcacccagcagtgtcatttcctgcgtcagtctggtcacacagagaaggcgatttctctctttcaggccatgatggactttactttttacaaacccgacagtgtacgagagctgtccaccaagcagcaggttgaattctttgaaccattctgggacagcggagaggcaagggttggagagttgggggccagaggctggaaagcctggatggtccaacaagagaggggggggtggctacagcccagtgcagaggaagaagaagaggaggaggatgaggaggaggaggtgaaggatcggagacagcccagatggactgtctggctggatgtggagtcatctcgcgaagcagctcagtggctgccctggaggcctgacaaatccaagggccagtcagaagaggactgtgaagacccggacagacaggtgctatttgacgacatcggcccatccctaatttgcctgtcatcacccgagcttcagctgcagcttcttctccatttcatgtcgttcctagggctgcctgtggactctgcgctctttgctgcaccttctcagcctggcctgctgctagagaacctttcactgctgactcagggtattgacccgctgcgtcctctgacctcccatgacctacctgacactgggcttaacgctgtaggtcacatgacaactctccaaggaacaaagaagtgggcagggctgggaaagcagggtgagacgtttatcacaaatgtgttcaatatggtccaagccgtccttcctgtgcatcaccaggctatcctgtcactcagctggattcagtatgagaaacttaaggtcttgcgctgcctacgcagtggcaacaaaaagcgtctccgctctcagggcaagagcagcaagcgggtggccaagcgactgctcaaagaatccaataaccgctcgtcattggtgctgtggcgagagtatgctcacctggagtggatgctgggcaacgttgacgaagctcgcaaagtgttctctacagctacagcaatggggggaaccaaagggctaagtagccccagtctctgcgacctttgtctgctgtgggcacagctggaggtggagaacggagtggctgtgcgaggcgcagatctaactgatgtaactgcttccccagctgtcacagtgctaaccaagttagctgaaggaacctccacattctcttcatcctccgaccccctctctccagtctctgtcctgaaagccaggaggtcatatgaacagattctaacagccagtttggcagcactggataaggaccctaacaactctcagaccaacataaaaggtcaagagcacctgcttgaggagaagctgaggttgaaaggcctggttggctgctatgctctgttccagtacctcacagtgggcatccaagcagctaacgccgtctatagccaggctagagagaggatagaggagcagtatcacacattaacactggataagcagcccaacagtaatgagggagccaaccttgctagcaccgattccagcaactctgcagctgattcctgctacaccagcaggaactatatgaagaggctggcttctgagtgtgaagtattagcagtacagcaggcagctttgctgaggtaccacaacagtgtcagtgtgttccccttggcaacactaagacaaactctgacttctaccctctccacctggtgtagcagtgcacctctctggagtatatatgtacaggttgaggaccgttaccatagtgctggccgagcacgccgcttttttcattctgtaactaggcacaccgacagtgtggtgccacgcctttttgccattgttgtcgaacaacaaaggaagcagctggtggacgctgctcagaagtcttgttgccatgacgctgccttgcccatccttccagagaatggcctcagcaaccgtatccgtggactgtttgaaactgccatagcaacagagataggtgctcactgtcctttagtttggaggatgtacatgcatttcctggtgtctgaagggaaggtggataaagccacagggatcttctacagggccttacagaatattccctgggctaagggcttgtacatggatgcagtgcagctgttccctgagcatctacaggagtttgttgatctgatgacagagaaagaactccgtctcagactgcctttagaagaactggatatactactggaagactgaacacacattcaagggctcactttgagtttgcttaagtggcaatatgacacctcacatattagcacacttaaagactacaggagatacacacctgagttcagatttatccacatataccctagctgttgtattaaacagtgatgttgcagtgatcttatgtaaagatgagcagagaagctacccttttgacatattgtctgaaatgctttattttaacaatataaatttgtttcagtacctgagatcttcaataaatgtaattctcattta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]