ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-11-04 01:10:23, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_026300047 3145 bp mRNA linear VRT 08-JUL-2025 DEFINITION PREDICTED: Mastacembelus armatus argonaute RISC catalytic component 3b (ago3b), transcript variant X2, mRNA. ACCESSION XM_026300047 VERSION XM_026300047.1 DBLINK BioProject: PRJNA489256 KEYWORDS RefSeq. SOURCE Mastacembelus armatus (zig-zag eel) ORGANISM Mastacembelus armatus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Anabantaria; Synbranchiformes; Mastacembelidae; Mastacembelus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_046643.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_900324485.2-RS_2025_07 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.4 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 07/03/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3145 /organism="Mastacembelus armatus" /mol_type="mRNA" /db_xref="taxon:205130" /chromosome="11" gene 1..3145 /gene="ago3b" /note="argonaute RISC catalytic component 3b; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 41 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:113126172" CDS 379..2961 /gene="ago3b" /codon_start=1 /product="protein argonaute-3 isoform X2" /protein_id="XP_026155832.1" /db_xref="GeneID:113126172" /translation="
MEIGTTGAVGAQALFSLPRRPGYGSIGKPIKLLANCFQVEIPKIDIYLYEVDIKPDKCPRRVNREVVDSMVQHFKVTIFGDRMPVYDGKKSLYTANALPVATGGVDLDVTLPGEGGKDRPFKVTIRFVSLVSWHMLHEVLTGGSVPKTLDLEKPLSTNPVHAVDVVLRHLPSMKYTPVGRSFFSSPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLSDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASLQTFPLQLENGQTVERTVAQYFREKYSLHLKYPHMPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYEADPFVQEFQFRVRDEMAQVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREDILKIFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRYKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKEYQPGITYIVVQKRHHTRLFCADRNERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADEFQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQVLAKAVQIHHDTLRTMYFA"
misc_feature 595..879
/gene="ago3b"
/note="N-terminal domain of argonaute; Region: ArgoN;
pfam16486"
/db_xref="CDD:465134"
misc_feature 907..1059
/gene="ago3b"
/note="Argonaute linker 1 domain; Region: ArgoL1;
pfam08699"
/db_xref="CDD:462567"
misc_feature 1060..1422
/gene="ago3b"
/note="PAZ domain, argonaute_like subfamily. Argonaute is
part of the RNA-induced silencing complex (RISC), and is
an endonuclease that plays a key role in the RNA
interference pathway. The PAZ domain has been named after
the proteins Piwi,Argonaut, and Zwille; Region:
PAZ_argonaute_like; cd02846"
/db_xref="CDD:239212"
misc_feature order(1216..1218,1261..1263,1303..1305,1315..1317,
1369..1371,1390..1392,1396..1398)
/gene="ago3b"
/note="nucleic acid-binding interface [nucleotide
binding]; other site"
/db_xref="CDD:239212"
misc_feature 1555..2832
/gene="ago3b"
/note="PIWI domain, Argonaute-like subfamily. Argonaute is
the central component of the RNA-induced silencing complex
(RISC) and related complexes. The PIWI domain is the
C-terminal portion of Argonaute and consists of two
subdomains, one of which provides the...; Region:
Piwi_ago-like; cd04657"
/db_xref="CDD:240015"
misc_feature order(1966..1968,1978..1980,2014..2025,2032..2034,
2056..2058,2065..2067,2077..2079,2089..2091)
/gene="ago3b"
/note="5' RNA guide strand anchoring site [active]"
/db_xref="CDD:240015"
misc_feature order(2170..2172,2176..2178,2386..2388,2800..2802)
/gene="ago3b"
/note="active site"
/db_xref="CDD:240015"
ORIGIN
gagggcggtgcaggagccgacttcagaccggtttctctccgagatcgagcaggactctggggtagcgaagtgagtttgatacagagaaacaccgggttgtcacgttaattcacccgggaagacgaactcgatcaccgaccagtgcaagcgaaaacagtttaaacgacagagccgggaacattttgttgaacttggagctgtcagtttccgtcagagaaggggactttcagccgaggggactcccaagcggcccggttccacatcagcgaccggagccgggaagcggcgtgtcggccagcgggtctgcagtcagagccttaaactacgccgggagaactgatcactgggtgccggggcatccggacagagaccccatgaatggaaatcggaacaacaggagccgttggagcccaagccctgttttcattgccaaggcgacccggctatggcagcatcgggaagcccatcaagcttttggccaactgcttccaggtggaaatccccaagattgacatctatttatatgaggtggacatcaaacctgataaatgtcctcgcagagtcaacagggaggtggtggattccatggttcagcatttcaaggtgaccatctttggtgatcgtatgccagtttatgatgggaagaaaagcctctacactgcaaatgcacttcctgttgccactggtggggtcgatttggatgtcaccctgccaggtgaaggtgggaaggatcgcccatttaaagtcaccattagatttgtgtcattggtcagctggcatatgctacacgaagtcttgacgggaggcagtgtacccaaaacgctggacctggagaagcctctcagcactaaccctgttcacgctgtggatgttgttcttcgacacctgccctccatgaagtacactcccgttggacgatccttcttctcttcccctgagggctacgatcatccactaggtggaggacgagaagtttggtttggtttccatcagtcagtacggccagccatgtggaaaatgatgctcaacattgatgtgtcagccacagccttttataaagcccagccagtcatccagttcatgtgtgaagtccttgacattcacaacattgatgagcagccccgtcctctctctgactcccacagggtcaagtttaccaaagagatcaaaggtcttaaagtggaagtgacacactgtggaactatgcgtaggaagtacagagtttgcaacgtaacacgacgccctgccagcctgcagacatttccattgcagcttgagaatggtcagactgttgaacgcacagtggcgcagtactttagagagaaatacagtctgcatctgaaatacccccacatgccctgtctgcaggtgggccaggagcagaaacacacctacctgccactggaggtttgcaacattgtagcgggacagcgctgtattaaaaaactaacagacaaccagacatcaaccatgatcaaagcaacagcccgctcggcaccagacagacaggaagagatcagcaggctggtgcgcagtgcgaattatgaggccgacccgttcgttcaggagttccagttccgcgtacgtgatgagatggctcaggtgacaggccgcgtcctgccggcccccatgctgcagtatggcggcaggaaccgcacggtggccacacccagccatggggtgtgggacatgagggggaagcagttccacaccggagtggagatcaaaatgtgggccatcgcctgctttgccacccagaggcagtgccgagaagatatcctcaaaatcttcactgaccagctgcggaaaatctcaaaggatgctgggatgcccattcagggccagccgtgcttctgtaaatatgcccagggagctgacagtgtggagcccatgttcagacacctgaagaacacctacgccgggctgcagctcatcatcgtgatcttgcctggcaaaacacctgtctatgctgaggtgaagcgggtgggagacaccctcctgggcatggccacccagtgtgtccaggtgaagaacgtagtgaagacgtcccctcagaccctctccaacctctgcctcaagatcaacgtcaaactagggggcatcaacaatatcctggttccacaccaacgaccctctgtcttccagcagcctgtcatctttcttggggcagatgtcactcatcctccagcaggagatgggaaaaagccatctattgcagcggtggtgggcagtatggatgcccaccccagcaggtattgtgctacagtgcgtgtccagaggcccagacaggagatcatccaggatttggcctctatggttcgagagcttctgatccagttctacaaatcaacccgctacaaaccaaccaggattatcttctacagggacggagtgtcagagggccagttcagacaggtgctgtactatgagctgctggcaatcagagaagcctgcatcagtctagagaaagaatatcagccagggattacctacatcgtcgtgcaaaaacgccatcacacgcgcctcttctgtgccgatcgtaatgagcgggttggacgaagtggaaacattcctgctggcaccacagtggacacagacatcacccacccctatgagtttgacttttacctctgcagtcacgctggaatccaaggtacaagtcgtccctcccactaccatgttttgtgggacgacaactgttttacagctgatgagttccagctcctcacataccagctgtgccacacctacgtccgctgcacacgctcggtctccatcccagcaccagcctactacgcccacttggtggccttccgcgcccgctaccacctggttgacaaagagcatgacagtgcggagggcagccatgtctcagggcagagtaatggcagggaccctcaggtgctggccaaggctgttcagatccaccatgacacactgaggaccatgtacttcgcctgaaaagccacatccacatccctcagccagtgtctgacttctatcagccacctcatcccatcagccccatgctggtgcaccttggtgtaaggatgtaacaaaccagataggatttacactcacattatgcaatttgaagccagccggttgtttgcgtactgctgcccatgcatcactttcttctcca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]