GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-04 11:47:42, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_026300046            3166 bp    mRNA    linear   VRT 10-APR-2020
DEFINITION  PREDICTED: Mastacembelus armatus protein argonaute-3-like
            (LOC113126172), transcript variant X1, mRNA.
ACCESSION   XM_026300046
VERSION     XM_026300046.1
DBLINK      BioProject: PRJNA489256
KEYWORDS    RefSeq.
SOURCE      Mastacembelus armatus (zig-zag eel)
  ORGANISM  Mastacembelus armatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Anabantaria; Synbranchiformes; Mastacembelidae;
            Mastacembelus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_046643.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Mastacembelus armatus Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3166
                     /organism="Mastacembelus armatus"
                     /mol_type="mRNA"
                     /db_xref="taxon:205130"
                     /chromosome="11"
     gene            1..3166
                     /gene="LOC113126172"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 18 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 3 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:113126172"
     CDS             379..2982
                     /gene="LOC113126172"
                     /codon_start=1
                     /product="protein argonaute-3-like isoform X1"
                     /protein_id="XP_026155831.1"
                     /db_xref="GeneID:113126172"
                     /translation="
MEIGTTGAVGAQALFSLPRRPGYGSIGKPIKLLANCFQVEIPKIDIYLYEVDIKPDKCPRRVNREVVDSMVQHFKVTIFGDRMPVYDGKKSLYTANALPVATGGVDLDVTLPGEGGKDRPFKVTIRFVSLVSWHMLHEVLTGGSVPKTLDLEKPLSTNPVHAVDVVLRHLPSMKYTPVGRSFFSSPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLSDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASLQTFPLQLENGQTVERTVAQYFREKYSLHLKYPHMPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYEADPFVQEFQFRVRDEMAQVTGRVLPAPMLQYGGRVSSEPFMNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREDILKIFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRYKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKEYQPGITYIVVQKRHHTRLFCADRNERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADEFQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQVLAKAVQIHHDTLRTMYFA"
     misc_feature    595..879
                     /gene="LOC113126172"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    907..1059
                     /gene="LOC113126172"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    1060..1422
                     /gene="LOC113126172"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1216..1218,1261..1263,1303..1305,1315..1317,
                     1369..1371,1390..1392,1396..1398)
                     /gene="LOC113126172"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1555..2853
                     /gene="LOC113126172"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1987..1989,1999..2001,2035..2046,2053..2055,
                     2077..2079,2086..2088,2098..2100,2110..2112)
                     /gene="LOC113126172"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(2191..2193,2197..2199,2407..2409,2821..2823)
                     /gene="LOC113126172"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
gagggcggtgcaggagccgacttcagaccggtttctctccgagatcgagcaggactctggggtagcgaagtgagtttgatacagagaaacaccgggttgtcacgttaattcacccgggaagacgaactcgatcaccgaccagtgcaagcgaaaacagtttaaacgacagagccgggaacattttgttgaacttggagctgtcagtttccgtcagagaaggggactttcagccgaggggactcccaagcggcccggttccacatcagcgaccggagccgggaagcggcgtgtcggccagcgggtctgcagtcagagccttaaactacgccgggagaactgatcactgggtgccggggcatccggacagagaccccatgaatggaaatcggaacaacaggagccgttggagcccaagccctgttttcattgccaaggcgacccggctatggcagcatcgggaagcccatcaagcttttggccaactgcttccaggtggaaatccccaagattgacatctatttatatgaggtggacatcaaacctgataaatgtcctcgcagagtcaacagggaggtggtggattccatggttcagcatttcaaggtgaccatctttggtgatcgtatgccagtttatgatgggaagaaaagcctctacactgcaaatgcacttcctgttgccactggtggggtcgatttggatgtcaccctgccaggtgaaggtgggaaggatcgcccatttaaagtcaccattagatttgtgtcattggtcagctggcatatgctacacgaagtcttgacgggaggcagtgtacccaaaacgctggacctggagaagcctctcagcactaaccctgttcacgctgtggatgttgttcttcgacacctgccctccatgaagtacactcccgttggacgatccttcttctcttcccctgagggctacgatcatccactaggtggaggacgagaagtttggtttggtttccatcagtcagtacggccagccatgtggaaaatgatgctcaacattgatgtgtcagccacagccttttataaagcccagccagtcatccagttcatgtgtgaagtccttgacattcacaacattgatgagcagccccgtcctctctctgactcccacagggtcaagtttaccaaagagatcaaaggtcttaaagtggaagtgacacactgtggaactatgcgtaggaagtacagagtttgcaacgtaacacgacgccctgccagcctgcagacatttccattgcagcttgagaatggtcagactgttgaacgcacagtggcgcagtactttagagagaaatacagtctgcatctgaaatacccccacatgccctgtctgcaggtgggccaggagcagaaacacacctacctgccactggaggtttgcaacattgtagcgggacagcgctgtattaaaaaactaacagacaaccagacatcaaccatgatcaaagcaacagcccgctcggcaccagacagacaggaagagatcagcaggctggtgcgcagtgcgaattatgaggccgacccgttcgttcaggagttccagttccgcgtacgtgatgagatggctcaggtgacaggccgcgtcctgccggcccccatgctgcagtatggcggcagggtgagctctgaaccctttatgaaccgcacggtggccacacccagccatggggtgtgggacatgagggggaagcagttccacaccggagtggagatcaaaatgtgggccatcgcctgctttgccacccagaggcagtgccgagaagatatcctcaaaatcttcactgaccagctgcggaaaatctcaaaggatgctgggatgcccattcagggccagccgtgcttctgtaaatatgcccagggagctgacagtgtggagcccatgttcagacacctgaagaacacctacgccgggctgcagctcatcatcgtgatcttgcctggcaaaacacctgtctatgctgaggtgaagcgggtgggagacaccctcctgggcatggccacccagtgtgtccaggtgaagaacgtagtgaagacgtcccctcagaccctctccaacctctgcctcaagatcaacgtcaaactagggggcatcaacaatatcctggttccacaccaacgaccctctgtcttccagcagcctgtcatctttcttggggcagatgtcactcatcctccagcaggagatgggaaaaagccatctattgcagcggtggtgggcagtatggatgcccaccccagcaggtattgtgctacagtgcgtgtccagaggcccagacaggagatcatccaggatttggcctctatggttcgagagcttctgatccagttctacaaatcaacccgctacaaaccaaccaggattatcttctacagggacggagtgtcagagggccagttcagacaggtgctgtactatgagctgctggcaatcagagaagcctgcatcagtctagagaaagaatatcagccagggattacctacatcgtcgtgcaaaaacgccatcacacgcgcctcttctgtgccgatcgtaatgagcgggttggacgaagtggaaacattcctgctggcaccacagtggacacagacatcacccacccctatgagtttgacttttacctctgcagtcacgctggaatccaaggtacaagtcgtccctcccactaccatgttttgtgggacgacaactgttttacagctgatgagttccagctcctcacataccagctgtgccacacctacgtccgctgcacacgctcggtctccatcccagcaccagcctactacgcccacttggtggccttccgcgcccgctaccacctggttgacaaagagcatgacagtgcggagggcagccatgtctcagggcagagtaatggcagggaccctcaggtgctggccaaggctgttcagatccaccatgacacactgaggaccatgtacttcgcctgaaaagccacatccacatccctcagccagtgtctgacttctatcagccacctcatcccatcagccccatgctggtgcaccttggtgtaaggatgtaacaaaccagataggatttacactcacattatgcaatttgaagccagccggttgtttgcgtactgctgcccatgcatcactttcttctcca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]