GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-10-23 02:06:05, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_025656494             453 bp    mRNA    linear   PLN 06-JUL-2018
DEFINITION  Aspergillus piperis CBS 112811 hypothetical protein
            (BO85DRAFT_383017), partial mRNA.
ACCESSION   XM_025656494
VERSION     XM_025656494.1
DBLINK      BioProject: PRJNA479914
            BioSample: SAMN05660207
KEYWORDS    RefSeq.
SOURCE      Aspergillus piperis CBS 112811
  ORGANISM  Aspergillus piperis CBS 112811
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae;
            Aspergillus; Aspergillus subgen. Circumdati.
REFERENCE   1  (bases 1 to 453)
  AUTHORS   Vesth,T.C., Nybo,J., Theobald,S., Brandl,J., Frisvad,J.C.,
            Nielsen,K.F., Lyhne,E.K., Kogle,M.E., Kuo,A., Riley,R., Clum,A.,
            Nolan,M., Lipzen,A., Salamov,A., Henrissat,B., Wiebenga,A., De
            vries,R.P., Grigoriev,I.V., Mortensen,U.H., Andersen,M.R. and
            Baker,S.E.
  CONSRTM   DOE Joint Genome Institute
  TITLE     The genomes of Aspergillus section Nigri reveals drivers in fungal
            speciation
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 453)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (06-JUL-2018) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 453)
  AUTHORS   Mondo,S., Kuo,A., Riley,R., Clum,A., Nolan,M., Lipzen,A.,
            Salamov,A., Vesth,T.C., Nybo,J., Theobald,S., Brandl,J.,
            Frisvad,J.C., Nielsen,K.F., Lyhne,E.K., Kogle,M.E., Henrissat,B.,
            Wiebenga,A., De vries,R.P., Mortensen,U.H., Andersen,M.R.,
            Baker,S.E., Grigoriev,I.V., Nordberg,H.P., Cantor,M.N. and Hua,S.X.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (12-FEB-2018) DOE Joint Genome Institute, 2800 Mitchell
            Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_020291618).
            
            ##Metadata-START##
            Organism Display Name :: Aspergillus piperis CBS 112811
            GOLD Stamp ID         :: Gp0047234
            ##Metadata-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..453
                     /organism="Aspergillus piperis CBS 112811"
                     /mol_type="mRNA"
                     /strain="CBS 112811"
                     /culture_collection="CBS:112811"
                     /type_material="culture from holotype of Aspergillus
                     piperis"
                     /db_xref="taxon:1448313"
                     /chromosome="Unknown"
     gene            <1..>453
                     /locus_tag="BO85DRAFT_383017"
                     /db_xref="GeneID:37159896"
     CDS             1..453
                     /locus_tag="BO85DRAFT_383017"
                     /codon_start=1
                     /product="hypothetical protein"
                     /protein_id="XP_025510737.1"
                     /db_xref="GeneID:37159896"
                     /db_xref="JGIDB:Asppip1_383017"
                     /translation="
MLVLKLIESTTMDFRNLSFTLLLLSTTVMLYFRALLAHPIHIISTPESVQTAEPAPTDALAFLDEPVFKPLASHIADHPYPWRDKRPFQETNYALLMGAVQSLLEAEVDEEEGGVGLNEGHGQQDVVEINSSETYILWVGDKDDEKCSCA"
ORIGIN      
atgttggtcttaaagctcatcgaatccaccaccatggatttccgcaacctatcattcactctcctcctgctatccactacagtcatgttatatttcagggctctattagcgcatcccatccacattattagcacccctgaatcagtgcagactgcagaaccagcgccaaccgacgccctcgccttcctcgacgagcccgtcttcaaaccactggcatctcacatagcagaccacccatatccatggcgtgataaacgtccattccaggagaccaattatgcgttactcatgggtgcagttcaatctcttcttgaggctgaggttgacgaggaagagggtggtgtgggtttgaacgagggtcatgggcaacaggacgtcgttgagattaactcgtctgagacatacattctctgggttggggataaggatgatgagaagtgttcttgcgcttag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]