2025-07-01 07:24:29, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_025656494 453 bp mRNA linear PLN 22-FEB-2025 DEFINITION Aspergillus piperis CBS 112811 uncharacterized protein (BO85DRAFT_383017), partial mRNA. ACCESSION XM_025656494 VERSION XM_025656494.1 DBLINK BioProject: PRJNA479914 BioSample: SAMN05660207 KEYWORDS RefSeq. SOURCE Aspergillus piperis CBS 112811 ORGANISM Aspergillus piperis CBS 112811 Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae; Aspergillus; Aspergillus subgen. Circumdati. REFERENCE 1 (bases 1 to 453) AUTHORS Vesth,T.C., Nybo,J., Theobald,S., Brandl,J., Frisvad,J.C., Nielsen,K.F., Lyhne,E.K., Kogle,M.E., Kuo,A., Riley,R., Clum,A., Nolan,M., Lipzen,A., Salamov,A., Henrissat,B., Wiebenga,A., De vries,R.P., Grigoriev,I.V., Mortensen,U.H., Andersen,M.R. and Baker,S.E. CONSRTM DOE Joint Genome Institute TITLE The genomes of Aspergillus section Nigri reveals drivers in fungal speciation JOURNAL Unpublished REFERENCE 2 (bases 1 to 453) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (22-FEB-2025) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 453) AUTHORS Mondo,S., Kuo,A., Riley,R., Clum,A., Nolan,M., Lipzen,A., Salamov,A., Vesth,T.C., Nybo,J., Theobald,S., Brandl,J., Frisvad,J.C., Nielsen,K.F., Lyhne,E.K., Kogle,M.E., Henrissat,B., Wiebenga,A., De vries,R.P., Mortensen,U.H., Andersen,M.R., Baker,S.E., Grigoriev,I.V., Nordberg,H.P., Cantor,M.N. and Hua,S.X. CONSRTM DOE Joint Genome Institute TITLE Direct Submission JOURNAL Submitted (12-FEB-2018) DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598-1698, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_020291618). ##Metadata-START## Organism Display Name :: Aspergillus piperis CBS 112811 GOLD Stamp ID :: Gp0047234 ##Metadata-END## COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..453 /organism="Aspergillus piperis CBS 112811" /mol_type="mRNA" /strain="CBS 112811" /culture_collection="CBS:112811" /type_material="culture from holotype of Aspergillus piperis" /db_xref="taxon:1448313" /chromosome="Unknown" gene <1..>453 /locus_tag="BO85DRAFT_383017" /db_xref="GeneID:37159896" CDS 1..453 /locus_tag="BO85DRAFT_383017" /codon_start=1 /product="uncharacterized protein" /protein_id="XP_025510737.1" /db_xref="GeneID:37159896" /db_xref="JGIDB:Asppip1_383017" /translation="
MLVLKLIESTTMDFRNLSFTLLLLSTTVMLYFRALLAHPIHIISTPESVQTAEPAPTDALAFLDEPVFKPLASHIADHPYPWRDKRPFQETNYALLMGAVQSLLEAEVDEEEGGVGLNEGHGQQDVVEINSSETYILWVGDKDDEKCSCA"
ORIGIN
atgttggtcttaaagctcatcgaatccaccaccatggatttccgcaacctatcattcactctcctcctgctatccactacagtcatgttatatttcagggctctattagcgcatcccatccacattattagcacccctgaatcagtgcagactgcagaaccagcgccaaccgacgccctcgccttcctcgacgagcccgtcttcaaaccactggcatctcacatagcagaccacccatatccatggcgtgataaacgtccattccaggagaccaattatgcgttactcatgggtgcagttcaatctcttcttgaggctgaggttgacgaggaagagggtggtgtgggtttgaacgagggtcatgggcaacaggacgtcgttgagattaactcgtctgagacatacattctctgggttggggataaggatgatgagaagtgttcttgcgcttag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]