GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 07:43:01, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_025208052            2433 bp    mRNA    linear   VRT 04-JUN-2018
DEFINITION  PREDICTED: Alligator sinensis protein argonaute-1 (LOC102373826),
            transcript variant X3, mRNA.
ACCESSION   XM_025208052
VERSION     XM_025208052.1
DBLINK      BioProject: PRJNA221633
KEYWORDS    RefSeq.
SOURCE      Alligator sinensis (Chinese alligator)
  ORGANISM  Alligator sinensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Crocodylia; Alligatoridae;
            Alligatorinae; Alligator.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_005842217.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Alligator sinensis Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2433
                     /organism="Alligator sinensis"
                     /mol_type="mRNA"
                     /db_xref="taxon:38654"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="China: Changxing Yinjiabian Chinese Alligator
                     Nature Reserve, Zhejiang Province"
                     /collection_date="08-Nov-2010"
     gene            1..2433
                     /gene="LOC102373826"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 8 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:102373826"
     CDS             149..2404
                     /gene="LOC102373826"
                     /codon_start=1
                     /product="protein argonaute-1 isoform X3"
                     /protein_id="XP_025063837.1"
                     /db_xref="GeneID:102373826"
                     /translation="
MSTQSQQVREVVEYMVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWMAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHISGQSNGRDPQALAKAVQVHQDTLRTMYFA"
     misc_feature    233..457
                     /gene="LOC102373826"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    485..637
                     /gene="LOC102373826"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    638..1000
                     /gene="LOC102373826"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(794..796,839..841,881..883,893..895,947..949,
                     968..970,974..976)
                     /gene="LOC102373826"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1133..2275
                     /gene="LOC102373826"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1544..1546,1556..1558,1592..1603,1610..1612,
                     1634..1636,1643..1645,1655..1657,1667..1669)
                     /gene="LOC102373826"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1748..1750,1754..1756,1964..1966,2243..2245)
                     /gene="LOC102373826"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
tgccacccttacagcaggtatttcaagcaccacgccggcccgggataggaaccgtcgggaagcccatcaagctcttggccaactactttgaagtggacattcccaagatcgatgtctatcactatgaagtggatatcaaacccgacaaatgtccacgcagagtcaacaggtaagagaggtggtggaatatatggtacaacacttcaaacctcagatcttcggtgaccgcaagccagtatacgatgggaagaaaaacatttacactgtcactgctttgcccattggaaatgaacgggttgactttgaggtaacaattccgggagaaggcaaggacaggatctttaaggtttccataaagtggatggcaatcgtgagctggcggatgctgcatgaagcccttgtgagcgggcagatccctgtccctctggaatcagtccaggcgctggacgtggccatgcgccatctggcttcaatgaggtacactcccgtgggccgctcctttttctctcccccggaaggttactaccacccccttggtgggggcagggaggtttggtttggattccatcagtccgtcaggcctgccatgtggaagatgatgctcaacattgatgtgtcggcaacggctttctacaaagcccagcctgtgattgagttcatgtgcgaagtgctggacatccggaacattgacgagcagccgaagcccctgacggattcacagagggtgcgcttcactaaggagatcaaaggtttgaaagtagaggtgacccactgtgggcagatgaagaggaaataccgtgtgtgtaatgttaccaggcgaccagccagtcaccaaacgttccccctgcagctggagagtggccagactgtggagtgcacggtggctcagtactttaagcagaaatacaacctgcagctgaaatacccccacctaccatgtctgcaggttggccaggaacagaagcacacatacctgccactggaggtgtgtaacattgtggcaggccagcgctgcatcaagaagctaacagacaatcagacgtcaaccatgataaaggcaacagcaaggtccgccccggacaggcaagaggaaatcagccgcctgatgaaaaatgccagttacaacctagatccgtacatacaggagtttgggataaaggtgaaggatgacatgacggaggtgactgggagggtccttcctgcaccaatcctacagtatggaggacggaaccgggcgatcgccactcccaaccagggcgtgtgggatatgcgcgggaagcagttctacaacggcattgagatcaaagtgtgggccatcgcatgctttgcccctcagaagcagtgtcgagaagaggtgctgaagaacttcacagaccagctgcgcaagatatccaaggatgcagggatgccaatccagggacagccatgcttctgtaaatacgcccagggcgcagacagcgtggagcccatgttccgacacctcaaaaacacctactcagggctccagctcatcattgtcatcctaccagggaaaacacccgtgtatgcggaggtaaagcgtgtgggggacacgctcctggggatggccacacagtgtgttcaggtcaagaacgtggtgaagacctctccacaaaccctctccaatctctgcctcaagatcaatgtcaagttgggtggaatcaacaacatcctcgtgcctcatcagcgctcggccgtctttcagcagccagtgattttcctcggagctgatgtcactcacccgccagcaggagatgggaagaagccttccatcacagctgttgtgggcagcatggatgcccacccgagccgttactgtgccacggtgcgtgtgcagcgaccacgacaggagattatcgaggacttgtcatacatggtgagggaacttcttatccagttctacaagtccacccgcttcaagcccaccaggatcatcttctatcgggacggggttcccgaggggcagctcccgcagattggcaagagtggcaacatcccggcaggaacaactgtggataccaacatcacccacccatttgaattcgacttctacctttgcagtcatgcaggcattcagggtacgagcagaccttcccattactacgtcctctgggatgacaaccggtttacagcggatgagctgcagatcctcacgtaccagctctgtcacacctatgtgcggtgcacccgctctgtctccatcccagcaccagcatactatgcccggttagtggcattcagggcacgataccacctcgtggacaaagagcacgacagtggcgagggcagccatatatccggacagagcaacgggcgagatccccaggccctggcaaaggctgtgcaggttcatcaggacactttacgtaccatgtactttgcttgaaagcctaacttttttttacctcactcaag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]