2024-04-26 19:15:05, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_025181222 2965 bp mRNA linear VRT 04-JUN-2018 DEFINITION PREDICTED: Pelodiscus sinensis argonaute 3, RISC catalytic component (AGO3), transcript variant X2, mRNA. ACCESSION XM_025181222 VERSION XM_025181222.1 DBLINK BioProject: PRJNA221645 KEYWORDS RefSeq. SOURCE Pelodiscus sinensis (Chinese soft-shelled turtle) ORGANISM Pelodiscus sinensis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Testudinata; Testudines; Cryptodira; Trionychia; Trionychidae; Pelodiscus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_005851450.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Pelodiscus sinensis Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2965 /organism="Pelodiscus sinensis" /mol_type="mRNA" /isolate="Daiwa-1" /db_xref="taxon:13735" /chromosome="Unknown" /sex="female" /country="Japan: Saga" gene 1..2965 /gene="AGO3" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 8 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 48 samples with support for all annotated introns" /db_xref="GeneID:102448842" CDS 72..2504 /gene="AGO3" /codon_start=1 /product="protein argonaute-3 isoform X2" /protein_id="XP_025037007.1" /db_xref="GeneID:102448842" /translation="
MVPRRPGYGTMGKPIKLLANCFQVEIPKIDVYLYEVDIKPDKCPRRVNREVVDSMVQHFKVTIFGDRRPVYDGKRSLYTANPLPVATTGVDLDVTLPGEGGKDRPFKVSIKFVSRVSWHLLHEVLTGRTLPEPLELDKPISTNPVHAVDVVLRHLPSMKYTPVGRSFFSAPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYDADPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDR"
misc_feature 243..527 /gene="AGO3" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 555..707 /gene="AGO3" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 708..1070 /gene="AGO3" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(864..866,909..911,951..953,963..965,1017..1019, 1038..1040,1044..1046) /gene="AGO3" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1203..2480 /gene="AGO3" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1614..1616,1626..1628,1662..1673,1680..1682, 1704..1706,1713..1715,1725..1727,1737..1739) /gene="AGO3" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1818..1820,1824..1826,2034..2036,2448..2450) /gene="AGO3" /note="active site" /db_xref="CDD:240015" ORIGIN
ttaaccattatgtttcgcttctaaattgtattgtttcctttacaggacccgtcggggcacagccccttcttatggtgcccagacgtcccggctatggcaccatgggcaaacctattaaattgctggccaactgcttccaagttgaaatcccaaagattgatgtctacctctatgaggtggatattaaaccagataagtgtcctcggagggtgaacagggaggtggtggactccatggtgcaacattttaaagtgacaatatttggggaccgtagaccagtttatgatgggaagagaagcctttatactgccaatccgctccctgtagcaaccactggggtagatttggatgtaacattaccaggagaaggtggaaaagatcgtcccttcaaggtgtcaataaagtttgtttctcgggtgagctggcacttgctgcatgaagttttgacaggaagaaccttgcctgagcctctggaattagacaaaccaatcagcactaaccctgttcatgctgttgatgtggtgctacgacacctgccctccatgaagtataccccagtgggccgatcctttttctctgctccagagggctatgatcaccctttgggagggggcagagaagtatggtttgggttccatcagtctgttcggcctgccatgtggaaaatgatgcttaatattgacgtttctgccactgccttctacaaagcacaacctgtaattcaattcatgtgtgaagttctcgacattcataacattgatgaacaaccaagacctctgactgattctcatcgggtaaaattcaccaaagagataaagggtctcaaggttgaagtgactcactgtggaacaatgagacggaaataccgtgtttgtaatgtaacaaggagacctgccagtcatcaaaccttccctttacagttagaaaatggccaaacagttgagagaacggtagcacagtacttcagagagaagtataacctccagctgaaatatcctcatctaccttgtctacaagtgggacaggagcagaaacatacttacctgcctctagaagtatgtaacattgtggccggtcagcgatgtatcaagaagctaacggacaatcagacatcaactatgataaaagcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgatgcagatccatttgttcaagagtttcagtttaaagtacgggatgagatggctcatgtgacaggacgtgtacttccagctccaatgttgcagtatggaggacggaatcgaacagtggcaaccccaagccatggtgtctgggatatgcgagggaaacagtttcacactggtgttgagatcaaaatgtgggccatagcttgctttgcaacacagagacaatgcagagaagaaatactgaagggatttacagatcagctacgcaagatttcaaaggatgcagggatgccaatccaaggccagccatgtttttgcaaatatgcacagggtgcggatagcgtggagccgatgttccgacacctgaaaaacacctattcagggctccaactcatcatcgtcatcctgccaggaaaaacacctgtgtacgcggaggtgaaacgtgtgggagatacgctgttggggatggccacacagtgcgttcaagtcaagaatgtcataaaaacatctcctcagactctctcaaacctgtgcctaaagattaatgttaaattaggaggaatcaacaacattcttgtacctcatcaacgaccttctgtgttccaacaaccagtgatcttcttgggagcagatgttactcatccacccgctggggatggaaagaagccttccattgctgctgttgtaggtagtatggatgctcatccaagcaggtattgtgccacagtgagagttcaaagacctcggcaggagattatccaagatttggcctccatggtaagagaacttctcatccagttctacaagtcaacgcgattcaaacccacgcgcatcattttctacagggatggggtttctgaaggacagtttcgacaggtgttgtattatgagctgctagcaattagagaggcctgcatcagtctggagaaagattaccagccaggaataacatacatcgtcgtgcagaaacgacatcacacacgtttgttctgtgcggacagaactgaacgggttggaagaagtggcaacattccagctggaacaactgtagatacagatattacacacccatatgagtttgatttttacctctgtagccatgctggaatacagggtaccagccgtccctctcactatcatgttttgtgggatgataactgttttactgcagatgaacttcagctgctgacttaccagctctgtcacacatatgtgcgttgcacacgatctgtttctatacctgcaccagcgtattatgctcacctggtagcattcagagcaagatatcatcttgtggataaagaacatgacaggtaaatgaaaatacaagtgtttagatttatgttctctttcagccctcagtccaaaaccttttccctattgtcaggctttaaactatctaattgtagtttagcagtccccaaatattttccctgcatgaactcattttcacatgtactccttcctgcaaccctagacatcctggcaaatgctgtttaaaaaaggcatcttccttgcagcatgacctcacacactctctctctattttgtattacaaagtggcattctatgcacagtgtgaccttgctcacatatggtgtgagatcacattgcatagagcaggcgctagtctgcagaacagcaaagtgtcctccaggcagcatgacatcacatgtactatgtatatgatatcatgttgttcgaaagataccattttgccagaggtgtagccatgttaaactgtaacttttaaaaatgagtagccctttggtaccttc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]