GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:38:02, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_024651181            3513 bp    mRNA    linear   INV 10-APR-2018
DEFINITION  Strongyloides ratti Argonaute/Dicer protein, PAZ domain and Stem
            cell self-renewal protein Piwi domain and Ribonuclease H-like
            domain and Protein of unknown function DUF2650 family-containing
            protein (SRAE_2000036100), partial mRNA.
ACCESSION   XM_024651181
VERSION     XM_024651181.1
DBLINK      BioProject: PRJNA304930
            BioSample: SAMEA1682816
KEYWORDS    RefSeq.
SOURCE      Strongyloides ratti
  ORGANISM  Strongyloides ratti
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Panagrolaimoidea; Strongyloididae; Strongyloides.
REFERENCE   1  (bases 1 to 3513)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-APR-2018) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   2
  AUTHORS   Aslett,A.Martin.
  TITLE     Direct Submission
  JOURNAL   Submitted (16-SEP-2014) WTSI, Pathogen Informatics, Wellcome Trust
            Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge
            Cambridgeshire. CB10 1SA, United Kingdom
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_037308).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..3513
                     /organism="Strongyloides ratti"
                     /mol_type="mRNA"
                     /strain="ED321 Heterogonic"
                     /db_xref="taxon:34506"
                     /chromosome="2"
     gene            <1..>3513
                     /locus_tag="SRAE_2000036100"
                     /db_xref="GeneID:36378048"
     CDS             1..3513
                     /locus_tag="SRAE_2000036100"
                     /codon_start=1
                     /product="Argonaute/Dicer protein, PAZ domain and Stem
                     cell self-renewal protein Piwi domain and Ribonuclease
                     H-like domain and Protein of unknown function DUF2650
                     family-containing protein"
                     /protein_id="XP_024504884.1"
                     /db_xref="GeneID:36378048"
                     /db_xref="GOA:A0A090MXM3"
                     /db_xref="InterPro:IPR003100"
                     /db_xref="InterPro:IPR003165"
                     /db_xref="InterPro:IPR012337"
                     /db_xref="InterPro:IPR022559"
                     /db_xref="InterPro:IPR032472"
                     /db_xref="InterPro:IPR032474"
                     /db_xref="UniProtKB/TrEMBL:A0A090MXM3"
                     /translation="
MSNNYCESSSRQLHSYPSFTNNFDDSCDSKTSYNYSRKSPFIKEFLSSKSCSSTNYGLSNFKKQCNYPQEHSTEKISNDISSENFPSHDYPILPQFTGENLNSNTYLSNSSYSSDDSDNINFLLSNDETKSKPSSGFFTNSNSSQYSYEDDNGSLIKYAERPNFGCNGRVVSLKTNFFEITFSKAPVVMQYHVEITFSGTRNLERDENRNIFWKAVEEHPEIFPNKFALAYDGNHQLYVAGKINMKGDTHHQCILVNVSIWKDSRPSITFVVNITWCGPVLLDLKRDYTTVDQHRPVTPIQIIDIIFKQSLTCPFVEQSSNFYCWKSSAYRMPVNGADALSIGGAKQVWTGFFSAALVALGYRALLNVDIDYTVFYKPKISILQFLCDVLNEKYGSTNCNSKNLGSRYNNNYRNKGLYCDSYSGYNKFDEISISYLMRNGQEPWTVENLCEINRLTESEFKIFDDAIKGLKIRVRSKDGHQRVYRVNGTKGSADQLTFFIKVGDKDEKTSVADYFQKKYGSLKYPSLPCLHVGPYHRNTYFPLEVCYLEDHQKYTKKLSEKHTAAIIKAAAVDAQQREDRIQALFKDACFENDLFLKSFGLSIAPKMVEVIGRVIEPPGIQYGPNINPNIDTKVFPIDGAWSMDNQSLYLPATCESYALMALISPKDEHILQNFAINLAQKAQQMGMKFPNWPDVVKYGRAVPFEIKTLYREISEYYVHSGKNCSLVIIVLPCKNADVYMTIKENSDVCYGVMSQCILYKNVSRLSPATLSNLILKLNLKLGGINAAITPNNMNDKYLINQPTLVIGIDVTHPTQIEMKNHVPSVAAVVGNIDMYPQTFAATVIVQKKCRQEVVDLVQAMVIRIKHFKECTGMKPKRILVYRDGVSEGQFQEVMKKEMVGIRNACRLFDPNYNPPITYIVVQKRHHARMFCRHLNDAVGKARNIPPGTIVDTGITSSDGFDFYLCSHFGIQGTSRPAHYHVLWDDSKFTSDEIQALSYHLCHNFGRCNRSVSIPTPVYYADLVCTRSRLHVKRALGVLETDNEYDDVSPSGIHLPHRKELFKNLGVYSVIGTQEAMGLWCPGYLLGPQCEEDGILTYSECCGDLHHQCCTNLRYWVIFLLVTSSITILLIFGICLWKKVFQNKTNNFIETRQPPRSGYTPGVRTGRPDAI"
     misc_feature    1342..1638
                     /locus_tag="SRAE_2000036100"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1450..1452,1492..1494,1531..1533,1543..1545,
                     1594..1596,1615..1617,1621..1623)
                     /locus_tag="SRAE_2000036100"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1783..3090
                     /locus_tag="SRAE_2000036100"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(2215..2217,2227..2229,2263..2274,2281..2283,
                     2305..2307,2314..2316,2326..2328,2338..2340)
                     /locus_tag="SRAE_2000036100"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(2425..2427,2431..2433,2647..2649,3061..3063)
                     /locus_tag="SRAE_2000036100"
                     /note="active site"
                     /db_xref="CDD:240015"
     misc_feature    3265..3363
                     /locus_tag="SRAE_2000036100"
                     /note="Protein of unknown function (DUF2650); Region:
                     DUF2650; pfam10853"
                     /db_xref="CDD:313936"
ORIGIN      
atgtctaataattattgtgaatcatcatctaggcaactacatagttacccgagtttcacaaacaattttgatgattcatgtgattcaaagacatcttataattacagcagaaaatctccatttattaaagagtttctatcatcaaaatcatgttcttcaacaaattatggtttgagtaattttaaaaaacaatgtaattatccacaagaacattcaacagaaaaaatttctaatgatatatcctctgaaaattttccatcacatgactatccaattttacctcaatttactggagaaaatttaaattcaaatacatatctaagtaattcatcatattcctctgatgatagtgataatattaattttttgttgtcaaatgatgaaactaaaagtaaaccatcttcagggttttttacaaattcgaattcttcacaatattcttatgaagatgacaatggttcattaattaaatatgctgaaaggccaaattttggatgtaatggcagagttgtttctttaaaaacaaatttttttgaaataacattttcaaaggctccagttgttatgcaatatcatgttgaaattacttttagtggtacacgtaatttagaacgtgatgaaaatagaaatatattttggaaagcagttgaagaacatcctgagatatttcctaataaatttgcacttgcttatgatggaaaccaccaattatatgtagctggtaaaattaatatgaaaggagatacgcatcatcaatgtattcttgtaaatgtatcaatttggaaagattctagacctagcattacttttgttgttaatattacatggtgtggacctgttttattagatttaaaaagagactatactacagttgatcaacatcgtcctgttacaccgattcaaattattgatattatttttaaacaaagtcttacttgcccatttgtagaacaatcttctaatttctattgttggaaatcatcagcttatcgtatgcctgttaatggtgctgatgctttgtcaattggtggtgctaaacaagtttggacaggatttttttcagctgctcttgtagcattaggatatagagctcttcttaatgttgatattgattatacagttttttataaaccaaaaatttcaattttacaatttctatgtgatgttttaaatgaaaaatatggatcaacaaattgtaattcaaaaaatcttggttctagatataataataattatagaaataaaggattatattgtgactcatattctggatataataaatttgatgaaatatctatttcatatcttatgagaaatggtcaggaaccgtggacagttgaaaatttgtgtgaaataaatcgtttaacagaatcagaatttaagatatttgatgacgccataaaaggattaaaaattcgtgtacgttcaaaagatgggcatcaaagagtgtaccgtgttaatggaactaaaggatcagctgatcaacttacttttttcataaaagttggtgacaaagatgagaaaacttctgttgctgattattttcaaaagaaatatggttcacttaaatatccatctttaccatgtttacatgttggtccatatcatagaaatacatattttccattggaagtttgttacttagaagatcatcaaaagtatacaaaaaaacttagtgaaaaacacacagcagctattattaaagctgctgctgttgatgctcaacaaagagaagatagaattcaagcattatttaaagatgcatgttttgaaaatgatctatttttaaaaagttttggtcttagtattgctccaaagatggttgaagtaattggaagagttattgaacctcctggtatacaatatggtccaaatattaatcctaacatagatactaaggtttttccaatagatggtgcatggagtatggataatcaatcgttatatttaccagcaacttgtgaatcctatgcattaatggctttaatatctcctaaagatgaacatatattacaaaattttgcaataaacttagctcagaaagctcaacaaatgggtatgaaatttccaaactggccagatgttgttaaatatggtagagcagtaccatttgaaataaaaacgttgtatcgtgaaataagtgaatattatgttcattcgggaaaaaattgtagtcttgttataatagttcttccatgtaaaaatgcagatgtttatatgacaataaaagaaaattctgatgtttgttatggagttatgtcacaatgtattttatataaaaatgtttctaggctttctccagcaacacttagtaatttaatacttaaattaaatcttaaattaggtggtataaatgcagcaattacacctaataatatgaatgataaatatcttataaatcaaccaacattagttattggtattgatgtaactcatccaacacaaattgaaatgaaaaatcatgtaccatcagttgctgctgttgttggtaatattgatatgtatccacaaacttttgctgctacagttattgttcaaaagaaatgtcgtcaagaagttgttgaccttgttcaagctatggttataagaatcaaacattttaaagaatgtactggaatgaaaccaaaaagaattttagtttatagagatggtgtttcagaaggacaatttcaagaagttatgaaaaaagaaatggttggtattagaaatgcatgtcgattatttgatccaaattacaatccaccaataacttatatagttgttcaaaaacggcatcatgcaagaatgttttgtagacatttaaatgatgctgttggaaaagctagaaatattccaccaggaactattgttgatacaggaattacatcttcagatggttttgacttttatctttgttcacattttggtattcaagggacaagtagacctgctcattatcatgttttatgggatgattctaaatttacatctgatgagattcaagcattaagttatcatctttgtcataattttggaagatgtaatagaagtgtatcaattcctacacctgtatattatgctgatttagtttgtacaagatcaagacttcatgttaaaagagctttaggtgttttagaaacagataatgaatatgatgatgtttcaccatcaggaattcatttacctcatcgtaaagaattatttaaaaacttaggagtttattctgttattggtacacaagaagctatgggtttatggtgtccaggatatcttcttggaccacaatgtgaagaagatggaattttgacgtattcagaatgttgtggagatctacatcatcaatgttgtacaaatttaagatattgggttatttttttactcgttacttcttcaataactattttattgatattcggtatttgtttatggaaaaaagtttttcaaaataaaacaaataattttattgaaacaaggcaacctccaagaagtggatatactccaggtgtcagaacaggaagacccgacgctatttaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]