GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 22:21:10, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_024650915             903 bp    mRNA    linear   INV 10-APR-2018
DEFINITION  Strongyloides ratti Argonaute/Dicer protein, PAZ domain and Stem
            cell self-renewal protein Piwi domain and Ribonuclease H-like
            domain-containing protein (SRAE_2000012500), partial mRNA.
ACCESSION   XM_024650915
VERSION     XM_024650915.1
DBLINK      BioProject: PRJNA304930
            BioSample: SAMEA1682816
KEYWORDS    RefSeq.
SOURCE      Strongyloides ratti
  ORGANISM  Strongyloides ratti
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Panagrolaimoidea; Strongyloididae; Strongyloides.
REFERENCE   1  (bases 1 to 903)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-APR-2018) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   2
  AUTHORS   Aslett,A.Martin.
  TITLE     Direct Submission
  JOURNAL   Submitted (16-SEP-2014) WTSI, Pathogen Informatics, Wellcome Trust
            Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge
            Cambridgeshire. CB10 1SA, United Kingdom
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_037308).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..903
                     /organism="Strongyloides ratti"
                     /mol_type="mRNA"
                     /strain="ED321 Heterogonic"
                     /db_xref="taxon:34506"
                     /chromosome="2"
     gene            <1..>903
                     /locus_tag="SRAE_2000012500"
                     /db_xref="GeneID:36377809"
     CDS             1..903
                     /locus_tag="SRAE_2000012500"
                     /codon_start=1
                     /product="Argonaute/Dicer protein, PAZ domain and Stem
                     cell self-renewal protein Piwi domain and Ribonuclease
                     H-like domain-containing protein"
                     /protein_id="XP_024504645.1"
                     /db_xref="GeneID:36377809"
                     /db_xref="GOA:A0A090LD44"
                     /db_xref="InterPro:IPR003100"
                     /db_xref="InterPro:IPR003165"
                     /db_xref="InterPro:IPR012337"
                     /db_xref="InterPro:IPR032472"
                     /db_xref="UniProtKB/TrEMBL:A0A090LD44"
                     /translation="
MELLEVANYQRVKLKSQTPDQIRYLIKTCAINPPTRLFGIQRLFKALQVTNNEFLHYHNLTVQNNPIKVSGRVLESPKIAYANNRYVNTKTIFDIYKSQARQKDIFIEDCYEIKRVFSNEKYLEDLFIYLNKEKADFAIFLSPAKLTELHQLIKLFERIYDVTTEDSRHNTVKNIIFKKQYKTLDNILMKTNVKVGGFNYNLINSEMELIVNKNKLIIGIGFNHTRSGTSDGLTTVGFAANTTKDSSYFSLLVMENSSGLIIVNVNSVMQLLSHTMAIFVGLWRILLTTKIVSSVKKESL"
     misc_feature    118..243
                     /locus_tag="SRAE_2000012500"
                     /note="Argonaute linker 2 domain; Region: ArgoL2;
                     pfam16488"
                     /db_xref="CDD:318648"
     misc_feature    196..>804
                     /locus_tag="SRAE_2000012500"
                     /note="Piwi-like: PIWI domain. Domain found in proteins
                     involved in RNA silencing. RNA silencing refers to a group
                     of related gene-silencing mechanisms mediated by short RNA
                     molecules, including siRNAs, miRNAs, and
                     heterochromatin-related guide RNAs. The...; Region:
                     Piwi-like; cl00628"
                     /db_xref="CDD:321081"
     misc_feature    order(448..450,460..462,493..504,511..513,547..549,
                     556..558,568..570,580..582)
                     /locus_tag="SRAE_2000012500"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:239208"
ORIGIN      
atggaacttttagaagttgcaaattatcaaagagttaaactaaaatctcaaacaccagatcaaataagatatttaataaaaacatgtgctataaatcctcccactagactttttggcatacaacgtttatttaaagctctccaagtaacaaataatgaatttcttcattatcataatttaacagtacaaaataatccaataaaagtttctggacgtgtattggagtcacctaaaattgcttatgctaataatcgctatgttaatactaaaacaatttttgatatttataaaagtcaagcaagacaaaaagatatttttattgaagattgttatgaaataaaacgagttttttcaaatgaaaagtatcttgaagatttatttatttatcttaataaagaaaaagcagattttgctatatttttatcacctgctaaattaacagaattgcatcaattaatcaaattatttgaaagaatatatgatgtaacaactgaagattcaagacataatactgttaagaatataatttttaaaaaacaatataaaacattagataatattcttatgaaaactaatgttaaagttggtggattcaattataatttaattaattcagaaatggaattaattgttaataaaaataaacttattattggaattggttttaatcatacaagaagtggtacttctgatggattaacaactgttggatttgctgctaatacaaccaaagattcttcatatttctcacttttggttatggaaaactccagtggccttataatagtcaatgtgaattcagtaatgcaactgctttcacatactatggctattttcgtcggtttatggcggattcttttgacaacgaagattgtgtcgtcggtaaaaaaagaatcgttgtag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]