GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 03:43:42, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XM_024447758            9643 bp    mRNA    linear   PRI 17-AUG-2020
DEFINITION  PREDICTED: Homo sapiens transforming acidic coiled-coil containing
            protein 2 (TACC2), transcript variant X3, mRNA.
ACCESSION   XM_024447758
VERSION     XM_024447758.1
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000010.11) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200815
            Annotation Version          :: 109.20200815
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..9643
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
     gene            1..9643
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="transforming acidic coiled-coil containing protein
                     2; Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 4 mRNAs, 153 ESTs, 48 long SRA reads, 10
                     Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 5 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:10579"
                     /db_xref="HGNC:HGNC:11523"
                     /db_xref="MIM:605302"
     variation       1
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:949736791"
     variation       3
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981404472"
     variation       16..17
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1203509893"
     variation       20
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1192795609"
     variation       40
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908449369"
     variation       41
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:193133228"
     variation       53
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776600076"
     variation       57
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429199747"
     variation       59
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898602883"
     variation       61
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542237873"
     variation       62
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185682553"
     variation       63
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371112179"
     variation       64
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891152794"
     variation       67
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565018724"
     variation       68
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008643574"
     variation       74
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1383631860"
     variation       75
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021241526"
     variation       78
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902739373"
     variation       81
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896720881"
     variation       83
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759136137"
     variation       84
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756798875"
     variation       86
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745326586"
     variation       87
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173514668"
     variation       89
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755669282"
     variation       96
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780679760"
     variation       99
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1320471019"
     variation       100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200528686"
     variation       104
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372926797"
     variation       105
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151268273"
     variation       106
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1451117201"
     variation       109
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774802156"
     variation       110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1368679552"
     variation       123
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368424069"
     variation       124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376941035"
     CDS             125..9157
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /codon_start=1
                     /product="transforming acidic coiled-coil-containing
                     protein 2 isoform X2"
                     /protein_id="XP_024303526.1"
                     /db_xref="GeneID:10579"
                     /db_xref="HGNC:HGNC:11523"
                     /db_xref="MIM:605302"
                     /translation="
MGNENSTSDNQEDSVLHNVILWPPNPEPTQRTLSAQTPRSAQPPGNSQNIKRKQQDTPGSPDHRDASSIGSVGLGGFCTASESSASLDPCLVSPEVTEPRKDPQGARGPEGSLLPSPPPSQEREHPSSSMPFAECPPEGCLASPAAAPEDGPQTQSPRREPAPNAPGDIAAAFPAERDSSTPYQEIAAVPSAGRERQPKEEGQKSSFSFSSGIDQSPGMSPVPLREPMKAPLCGEGDQPGGFESQEKEAAGGFPPAESRQGVASVQVTPEAPAAAQQGTESSAVLEKSPLKPMAPIPQDPAPRASDRERGQGEAPPQYLTDDLEFLRACHLPRSNSGAAPEAEVNAASQESCQQPVGAYLPHAELPWGLPSPALVPEAGGSGKEALDTIDVQGHPQTGMRGTKPNQVVCVAAGGQPEGGLPVSPEPSLLTPTEEAHPASSLASFPAAQIPIAVEEPGSSSRESVSKAGMPVSADAAKEVVDAGLVGLERQVSDLGSKGEHPEGDPGEVPAPSPQERGEHLNTEQSHEVQPGVPPPPLPKEQSHEVQPGAPPPPLPKAPSESARGPPGPTDGAKVHEDSTSPAVAKEGSRSPGDSPGGKEEAPEPPDGGDPGNLQGEDSQAFSSKRDPEVGKDELSKPSSDAESRDHPSSHSAQPPRKGGAGHTDGPHSQTAEADASGLPHKLGEEDPVLPPVPDGAGEPTVPEGAIWEGSGLQPKCPDTLQSREGLGRMESFLTLESEKSDFPPTPVAEVAPKAQEGESTLEIRKMGSCDGEGLLTSPDQPRGPACDASRQEFHAGVPHPPQGENLAADLGLTALILDQDQQGIPSCPGEGWIRGAASEWPLLSSEKHLQPSQAQPETSIFDVLKEQAQPPENGKETSPSHPGFKDQGADSSQIHVPVEPQEDNNLPTHGGQEQALGSELQSQLPKGTLSDTPTSSPTDMVWESSLTEESELSAPTRQKLPALGEKRPEGACGDGQSSRVSPPAADVLKDFSLAGNFSRKETCCTGQGPNKSQQALADALEEGSQHEEACQRHPGASEAADGCSPLWGLSKREMASGNTGEAPPCQPDSVALLDAVPCLPALAPASPGVTPTQDAPETEACDETQEGRQQPVPAPQQKMECWATSDAESPKLLASFPSAGEQGGEAGAAETGGSAGAGDPGKQQAPEKPGEATLSCGLLQTEHCLTSGEEASTSALRESCQAEHPMASCQDALLPARELGGIPRSTMDFSTHQAVPDPKELLLSGPPEVAAPDTPYLHVDSAAQRGAEDSGVKAVSSADPRAPGESPCPVGEPPLALENAASLKLFAGSLAPLLQPGAAGGEIPAVQASSGSPKARTTEGPVDSMPCLDRMPLLAKGKQATGEEKAATAPGAGAKASGEGMAGDAAGETEGSMERMGEPSQDPKQGTSGGVDTSSEQIATLTGFPDFREHIAKIFEKPVLGALATPGEKAGAGRSAVGKDLTRPLGPEKLLDGPPGVDVTLLPAPPARLQVEKKQQLAGEAEISHLALQDPASDKLLGPAGLTWERNLPGAGVGKEMAGVPPTLREDERPEGPGAAWPGLEGQAYSQLERSRQELASGLPSPAATQELPVERAAAFQVAPHSHGEEAVAQDRIPSGKQHQETSACDSPHGEDGPGDFAHTGVPGHVPRSTCAPSPQREVLTVPEANSEPWTLDTLGGERRPGVTAGILEMRNALGNQSTPAPPTGEVADTPLEPGKVAGAAGEAEGDITLSTAETQACASGDLPEAGTTRTFSVVAGDLVLPGSCQDPACSDKAPGMEGTAALHGDSPARPQQAKEQPGPERPIPAGDGKVCVSSPPEPDETHDPKLQHLAPEELHTDRESPRPGPSMLPSVPKKDAPRVMDKVTSDETRGAEGTESSPVADDIIQPAAPADLESPTLAASSYHGDVVGQVSTDLIAQSISPAAAHAGLPPSAAEHIVSPSAPAGDRVEASTPSCPDPAKDLSRSSDSEEAFETPESTTPVKAPPAPPPPPPEVIPEPEVSTQPPPEEPGCGSETVPVPDGPRSDSVEGSPFRPPSHSFSAVFDEDKPIASSGTYNLDFDNIELVDTFQTLEPRASDAKNQEGKVNTRRKSTDSVPISKSTLSRSLSLQASDFDGASSSGNPEAVALAPDAYSTGSSSASSTLKRTKKPRPPSLKKKQTTKKPTETPPVKETQQEPDEESLVPSGENLASETKTESAKTEGPSPALLEETPLEPAVGPKAACPLDSESAEGVVPPASGGGRVQNSPPVGRKTLPLTTAPEAGEVTPSDSGGQEDSPAKGLSVRLEFDYSEDKSSWDNQQENPPPTKKIGKKPVAKMPLRRPKMKKTPEKLDNTPASPPRSPAEPNDIPIAKGTYTFDIDKWDDPNFNPFSSTSKMQESPKLPQQSYNFDPDTCDESVDPFKTSSKTPSSPSKSPASFEIPASAMEANGVDGDGLNKPAKKKKTPLKTMVEDVMSVCSLFDTFRVKKSPKRSPLSDPPSQDPTPAATPETPPVISAVVHATDEEKLAVTNQKWTCMTVDLEADKQDYPQPSDLSTFVNETKFSSPTEGKQLCSQLDPHSASENPAPREPKARRETSQPELDYRNSYEIEYMEKIGSSLPQDDDAPKKQALYLMFDTSQESPVKSSPVRMSESPTPCSGSSFEETEALVNTAAKNQHPVPRGLAPNQESHLQVPEKSSQKELEAMGLGTPSEAIEITAPEGSFASADALLSRLAHPVSLCGALDYLEPDLAEKNPPLFAQKLQEELEFAIMRIEALKLARQIALASRSHQDAKREAAHPTDVSISKTALYSRIGTAEVEKPAGLLFQQPDLDSALQIARAEIITKEREVSEWKDKYEESRREVMEMRKIVAEYEKTIAQMIEDEQREKSVSHQTVQQLVLEKEQALADLNSVEKSLADLFRRYEKMKEVLEGFRKNEEVLKRCAQEYLSRVKKEEQRYQALKVHAEEKLDRANAEIAQVRGKAQQEQAAHQASLRKEQLRVDALERTLEQKNKEIEELTKICDELIAKMGKS"
     misc_feature    <191..1585
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Atrophin-1 family; Region: Atrophin-1; cl26464"
                     /db_xref="CDD:331285"
     misc_feature    <4748..6142
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Atrophin-1 family; Region: Atrophin-1; cl26464"
                     /db_xref="CDD:331285"
     misc_feature    <6674..7837
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Domain of unknown function (DUF4045); Region:
                     DUF4045; cl25751"
                     /db_xref="CDD:330572"
     misc_feature    8534..9136
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Transforming acidic coiled-coil-containing protein
                     (TACC); Region: TACC; pfam05010"
                     /db_xref="CDD:309929"
     variation       126
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349609278"
     variation       134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384553919"
     variation       136
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203183802"
     variation       137..138
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1269775765"
     variation       145
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215968267"
     variation       147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547823080"
     variation       148
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:886895560"
     variation       150
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283714338"
     variation       152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1212493882"
     variation       153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773505492"
     variation       160
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043082105"
     variation       161
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162984295"
     variation       166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567395106"
     variation       167
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458435301"
     variation       178
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536431472"
     variation       179
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748823611"
     variation       180
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1389657707"
     variation       184
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896032069"
     variation       187
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192677940"
     variation       191
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350812446"
     variation       200
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184660626"
     variation       202
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291011051"
     variation       210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323178740"
     variation       211
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244843089"
     variation       212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755476481"
     variation       213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991342276"
     variation       216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192689513"
     variation       217
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375461398"
     variation       221
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1307737191"
     variation       229
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754559620"
     variation       233
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779540446"
     variation       234
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753289073"
     variation       236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756120822"
     variation       239
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173681722"
     variation       240
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758684627"
     variation       244
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114344239"
     variation       245
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202197379"
     variation       246
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ccctc"
                     /db_xref="dbSNP:748791718"
     variation       246
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138166528"
     variation       247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745896242"
     variation       250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769907900"
     variation       253
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1591469852"
     variation       256
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774154821"
     variation       257
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761870489"
     variation       258
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771921628"
     variation       263
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375973608"
     variation       264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201980895"
     variation       266
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1238814181"
     variation       267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766081390"
     variation       272
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1591470042"
     variation       272
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369830070"
     variation       273
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554980725"
     variation       274..278
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:753443406"
     variation       275
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759087516"
     variation       280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370111299"
     variation       282
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764868224"
     variation       283
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115077750"
     variation       285
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758882459"
     variation       294
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540521848"
     variation       295
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751908069"
     variation       297
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1158155825"
     variation       298..299
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:763342425"
     variation       298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577387065"
     variation       299
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573681653"
     variation       305
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200691895"
     variation       310
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352400701"
     variation       312
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1320631404"
     variation       314
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393009319"
     variation       319
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140883324"
     variation       320
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780126824"
     variation       321
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749336283"
     variation       322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11200367"
     variation       323
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:760524024"
     variation       325
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1331467958"
     variation       326
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229314757"
     variation       327
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272791539"
     variation       330
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138597000"
     variation       332
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372977281"
     variation       334
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:952513086"
     variation       336
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968854951"
     variation       337
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369866874"
     variation       338
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769447853"
     variation       341
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450537702"
     variation       343
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401814880"
     variation       347
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:539346663"
     variation       348
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138796945"
     variation       350
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226301817"
     variation       351
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763550115"
     variation       352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774831593"
     variation       355
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437030329"
     variation       356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205587179"
     variation       359
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591801823"
     variation       360
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277726271"
     variation       361
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762252775"
     variation       362
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115572080"
     variation       364
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1237711421"
     variation       367
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750751342"
     variation       371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186166664"
     variation       372
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335659286"
     variation       376
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392544523"
     variation       382
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1450701880"
     variation       385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1173397369"
     variation       392
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191313839"
     variation       394
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756461782"
     variation       395
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754047980"
     variation       397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182633225"
     variation       400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1344864902"
     variation       403
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779193768"
     variation       404
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748251065"
     variation       406
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757192262"
     variation       417
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781309215"
     variation       422
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:574835006"
     variation       424
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769522022"
     variation       429
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1485880225"
     variation       431
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1220763436"
     variation       433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201040329"
     variation       434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1464196742"
     variation       435
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777133517"
     variation       437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866845498"
     variation       440
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139133884"
     variation       441
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143057039"
     variation       445
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773786012"
     variation       447
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761348528"
     variation       448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772523083"
     variation       449..450
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1228306033"
     variation       454
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773759070"
     variation       456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761069382"
     variation       457
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766722368"
     variation       472
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754078377"
     variation       473
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307904014"
     variation       477
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ccgc"
                     /db_xref="dbSNP:1161463614"
     variation       477
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:532147977"
     variation       478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565235917"
     variation       480
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369387017"
     variation       481
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373182521"
     variation       485
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329310218"
     variation       489
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200671128"
     variation       491
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377057058"
     variation       492
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781250337"
     variation       494
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035710398"
     variation       495
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750363676"
     variation       497
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898091499"
     variation       499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755931307"
     variation       501
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375164406"
     variation       504
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141987188"
     variation       505
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201984659"
     variation       506
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:778562836"
     variation       507
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591803099"
     variation       510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202231209"
     variation       511
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747638919"
     variation       512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453887168"
     variation       513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200011504"
     variation       514
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771610804"
     variation       517
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773704307"
     variation       518
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199673873"
     variation       523
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182894618"
     variation       524
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373788566"
     variation       526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1460951688"
     variation       527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161584714"
     variation       529
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388467605"
     variation       530
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147458352"
     variation       533
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324127475"
     variation       534
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376962666"
     variation       535
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139828953"
     variation       539
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763092038"
     variation       541
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142984046"
     variation       542
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755940383"
     variation       546
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1263231461"
     variation       549
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461610469"
     variation       554
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478832013"
     variation       558
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359072315"
     variation       559
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591803627"
     variation       561
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528115484"
     variation       562
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753531775"
     variation       564
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1482252348"
     variation       565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754820367"
     variation       571
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778507311"
     variation       572
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1471076806"
     variation       573
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423514696"
     variation       575..576
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1185497500"
     variation       575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233315473"
     variation       577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370193834"
     variation       579..581
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ctc"
                     /db_xref="dbSNP:752075521"
     variation       582
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1164077070"
     variation       583
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747863916"
     variation       585
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1427545282"
     variation       586
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198091564"
     variation       591
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:907693838"
     variation       592
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309677133"
     variation       601
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771559274"
     variation       602
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547871776"
     variation       603
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746532477"
     variation       605
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341684181"
     variation       606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244916642"
     variation       609..612
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:757693244"
     variation       610
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297465705"
     variation       613
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771302189"
     variation       614
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963734438"
     variation       617
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309046698"
     variation       619
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777216753"
     variation       620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328109752"
     variation       622
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215691127"
     variation       624
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746213186"
     variation       630
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283912221"
     variation       631
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770318243"
     variation       632
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1198883792"
     variation       633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78149003"
     variation       634
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774257197"
     variation       636
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139910468"
     variation       637
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774962316"
     variation       638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753858328"
     variation       645
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170249935"
     variation       646
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149820575"
     variation       647
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765076181"
     variation       649
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300665813"
     variation       659
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403948166"
     variation       663
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146707567"
     variation       664..667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tact"
                     /replace="tacttact"
                     /db_xref="dbSNP:781399781"
     variation       664
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41288000"
     variation       665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370732959"
     variation       667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763800934"
     variation       668
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781519455"
     variation       669
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746440335"
     variation       673..674
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:750447544"
     variation       674
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770267070"
     variation       675
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144016066"
     variation       679
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1483728396"
     variation       680
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1468971932"
     variation       682
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749704333"
     variation       685..699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tgc"
                     /replace="tgccgtccccagtgc"
                     /db_xref="dbSNP:1241686627"
     variation       688
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146425124"
     variation       689
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11200385"
     variation       695
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285355053"
     variation       696
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767703887"
     variation       697
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776420572"
     variation       704..712
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="agagaga"
                     /replace="agagagaga"
                     /db_xref="dbSNP:1432349259"
     variation       707
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173746849"
     variation       713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759412867"
     variation       714
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591805162"
     variation       717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765166194"
     variation       718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752447470"
     variation       722..728
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gaag"
                     /replace="gaagaag"
                     /db_xref="dbSNP:1385726721"
     variation       722
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763630843"
     variation       727
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946315751"
     variation       728
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199693945"
     variation       731
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756712964"
     variation       732
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780809477"
     variation       735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1303938289"
     variation       736
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312994030"
     variation       739..754
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ctccttctccttctcc"
                     /replace="ctccttctccttctccttctcc"
                     /db_xref="dbSNP:756169189"
     variation       739
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535065792"
     variation       741
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756620419"
     variation       742..746
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:780453024"
     variation       744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372806087"
     variation       745..749
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ct"
                     /replace="ctcct"
                     /db_xref="dbSNP:904541826"
     variation       745
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056487135"
     variation       747..748
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1331262700"
     variation       747
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780732675"
     variation       748..752
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:749452283"
     variation       752
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749651425"
     variation       753
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769108695"
     variation       755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996551474"
     variation       757
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779002808"
     variation       763
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559804804"
     variation       765
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418935659"
     variation       770
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772197780"
     variation       773..774
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1480646280"
     variation       773
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180939566"
     variation       782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773211037"
     variation       783
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458329823"
     variation       784
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159256265"
     variation       785
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1210607758"
     variation       789
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760776569"
     variation       791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456902268"
     variation       798
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1484897417"
     variation       806
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554657489"
     variation       810
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212250186"
     variation       812
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775453520"
     variation       814
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:768582523"
     variation       815
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764016618"
     variation       816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201276537"
     variation       817
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761467777"
     variation       818
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1412639970"
     variation       820
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767078887"
     variation       827
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772816568"
     variation       831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749906694"
     variation       833
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143195709"
     variation       835
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490439884"
     variation       836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1204226690"
     variation       837
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887986265"
     variation       839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591806245"
     variation       840
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357167335"
     variation       843
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780679682"
     variation       844
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754467303"
     variation       846
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374397256"
     variation       852
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1187512168"
     variation       853
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474401079"
     variation       854
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412361944"
     variation       855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779280100"
     variation       859
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543513548"
     variation       862
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772300166"
     variation       868
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429480913"
     variation       870
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777991788"
     variation       871
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747068095"
     variation       872
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367976637"
     variation       877
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591806585"
     variation       882
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307587628"
     variation       883
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283831210"
     variation       884
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775402055"
     variation       886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357019026"
     variation       887
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230128352"
     variation       888
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763000875"
     variation       889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1565239223"
     variation       889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768487816"
     variation       890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360133978"
     variation       896
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1390662729"
     variation       897
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1371086694"
     variation       902
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963804882"
     variation       903
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202928711"
     variation       904..908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1227375547"
     variation       905
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401149550"
     variation       906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:961816829"
     variation       908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774125717"
     variation       913
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761541862"
     variation       920
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767259677"
     variation       921
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151218566"
     variation       923
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201513169"
     variation       930
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241727330"
     variation       931
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386387813"
     variation       934
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449454104"
     variation       935
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370529132"
     variation       936..939
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:778835852"
     variation       943
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167097911"
     variation       944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753305212"
     variation       945..962
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cag"
                     /replace="cagcccagcagggcacag"
                     /db_xref="dbSNP:748180148"
     variation       948
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591807332"
     variation       953
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374044820"
     variation       956
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980875898"
     variation       958
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779322137"
     variation       960
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367593472"
     variation       962
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777936931"
     variation       965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747294941"
     variation       966
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757312128"
     variation       972
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371430835"
     variation       973
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200705484"
     variation       978
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227489270"
     variation       982
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768595912"
     variation       985
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:956566613"
     variation       986
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774206095"
     variation       987..992
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:1370204599"
     variation       987
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747945270"
     variation       989
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868558986"
     variation       991
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11816938"
     variation       992
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1389693868"
     variation       997
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591807814"
     variation       999
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1310129764"
     variation       1001
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591807847"
     variation       1005..1008
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1398024688"
     variation       1005
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866405275"
     variation       1007
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453441105"
     variation       1008
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146983657"
     variation       1009
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138069008"
     variation       1013
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758992994"
     variation       1014
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1187170370"
     variation       1016
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250472736"
     variation       1018
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542065957"
     variation       1019
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172409444"
     variation       1020
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1423311299"
     variation       1024
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380377116"
     variation       1031
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753182204"
     variation       1033
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191200763"
     variation       1036
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177423326"
     variation       1038
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750417915"
     variation       1043..1047
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1387926412"
     variation       1048
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433020020"
     variation       1052
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318414946"
     variation       1054
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758754668"
     variation       1055
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1431175414"
     variation       1059
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764496827"
     variation       1060
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1365049271"
     variation       1064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751934143"
     variation       1065
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143121367"
     variation       1066
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781422767"
     variation       1068
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150583771"
     variation       1069
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138162632"
     variation       1070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778907040"
     variation       1072
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347037820"
     variation       1075
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050895902"
     variation       1076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565240698"
     variation       1077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550713473"
     variation       1078
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:919300435"
     variation       1079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479216436"
     variation       1090
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200346563"
     variation       1095
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772149524"
     variation       1099
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455683413"
     variation       1105
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161527036"
     variation       1110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773078761"
     variation       1113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1387033561"
     variation       1114
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591808732"
     variation       1122
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929297984"
     variation       1126
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1401284240"
     variation       1130
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746834833"
     variation       1134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1347847504"
     variation       1136
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1324407499"
     variation       1138
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770661570"
     variation       1142
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776198678"
     variation       1144
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283488236"
     variation       1146
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759053524"
     variation       1149
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383137398"
     variation       1150
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149557136"
     variation       1159
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565241088"
     variation       1162
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776048491"
     variation       1163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570548726"
     variation       1165
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1209705359"
     variation       1170
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763389378"
     variation       1172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1455156905"
     variation       1175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764588961"
     variation       1181
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751880808"
     variation       1182
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757639386"
     variation       1185
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1471768319"
     variation       1196
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184077085"
     variation       1197
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767750830"
     variation       1198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1472519482"
     variation       1206
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770976617"
     variation       1207
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201912981"
     variation       1208..1210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cac"
                     /replace="cacac"
                     /db_xref="dbSNP:1263477888"
     variation       1209
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1426288932"
     variation       1210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377717933"
     variation       1211
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549925900"
     variation       1217..1247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ctgccctggggcttgccaagtcctgccctgg"
                     /replace="ctgccctggggcttgccaagtcctgccctggggcttgccaagtcctgc
                     cctgg"
                     /db_xref="dbSNP:771868818"
     variation       1219
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1330492288"
     variation       1220
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:552803087"
     variation       1222
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758375476"
     variation       1234
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591809454"
     variation       1236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777878485"
     variation       1241
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282912667"
     variation       1244
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746781383"
     variation       1248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247158967"
     variation       1257
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770886696"
     variation       1264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1482282700"
     variation       1266
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:995053150"
     variation       1268
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197718510"
     variation       1270
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226863673"
     variation       1276
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780889466"
     variation       1277
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324907028"
     variation       1278
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:566405955"
     variation       1285
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298001733"
     variation       1286
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185570831"
     variation       1289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758613158"
     variation       1290
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007789977"
     variation       1292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774795630"
     variation       1295
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762479718"
     variation       1298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969735887"
     variation       1300
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389257434"
     variation       1301
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1460295396"
     variation       1303
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980713186"
     variation       1307
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376621212"
     variation       1309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535017370"
     variation       1315
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762162854"
     variation       1321
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901976240"
     variation       1322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144408700"
     variation       1323
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760742195"
     variation       1325
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453929654"
     variation       1326
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866587992"
     variation       1329
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202181318"
     variation       1330
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753924739"
     variation       1334..1336
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1230121690"
     variation       1334
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252082508"
     variation       1336
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148794347"
     variation       1338
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751612350"
     variation       1342
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757057983"
     variation       1349
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1474737220"
     variation       1350
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1461837076"
     variation       1353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:868821748"
     variation       1354
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1189862285"
     variation       1355
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780788735"
     variation       1357
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:745676307"
     variation       1359
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426487505"
     variation       1361
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172330678"
     variation       1363
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368657688"
     variation       1364
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779778333"
     variation       1365
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747138914"
     variation       1369
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337545458"
     variation       1372
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537032352"
     variation       1373
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757642911"
     variation       1374
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050664023"
     variation       1376..1380
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:772831539"
     variation       1376
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141547215"
     variation       1377
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762250594"
     variation       1379
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746392374"
     variation       1380
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772637339"
     variation       1381
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591810674"
     variation       1383
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:980617843"
     variation       1384
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341585496"
     variation       1393
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330888994"
     variation       1394
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773412896"
     variation       1397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761126564"
     variation       1400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766491271"
     variation       1401
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944683633"
     variation       1406
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267403196"
     variation       1409
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754156600"
     variation       1410
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188044643"
     variation       1411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170827353"
     variation       1416
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146365477"
     variation       1417
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432401223"
     variation       1421
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765463510"
     variation       1423
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200855604"
     variation       1431
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576922376"
     variation       1433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202167155"
     variation       1434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750136554"
     variation       1436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755984690"
     variation       1443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436111855"
     variation       1447
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551434293"
     variation       1448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199400051"
     variation       1452
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866006967"
     variation       1453
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:929354267"
     variation       1454
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547161743"
     variation       1455
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390404370"
     variation       1463
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565243131"
     variation       1464
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049107667"
     variation       1466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357528024"
     variation       1471
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754640237"
     variation       1473
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778329449"
     variation       1475
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346442184"
     variation       1476
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227848615"
     variation       1480
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1440613961"
     variation       1481
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:905019210"
     variation       1483
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331422198"
     variation       1487
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747725878"
     variation       1490
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139655744"
     variation       1492
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773822206"
     variation       1501
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391745803"
     variation       1505
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747306614"
     variation       1506
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771396861"
     variation       1507
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776976997"
     variation       1508
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:943607533"
     variation       1509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759772113"
     variation       1510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765556704"
     variation       1513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377138456"
     variation       1517
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1405687927"
     variation       1520
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405087894"
     variation       1522
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763114778"
     variation       1523
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77657275"
     variation       1527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750412382"
     variation       1532
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1423107266"
     variation       1544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755855849"
     variation       1545
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200950997"
     variation       1546
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753635947"
     variation       1548
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146444857"
     variation       1556
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1375566982"
     variation       1557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1224439722"
     variation       1563
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767169175"
     variation       1564..1565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gg"
                     /replace="ggtggg"
                     /db_xref="dbSNP:746527471"
     variation       1566..1567
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="ctggg"
                     /db_xref="dbSNP:770390528"
     variation       1566
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565243782"
     variation       1568
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767997069"
     variation       1570
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428898394"
     variation       1574
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591812099"
     variation       1577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139482219"
     variation       1578
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176496381"
     variation       1582
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243488718"
     variation       1583
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757969790"
     variation       1586..1590
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gagag"
                     /replace="gagagag"
                     /db_xref="dbSNP:1452451864"
     variation       1588
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778142032"
     variation       1592
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203934329"
     variation       1593
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1230850944"
     variation       1595
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481309988"
     variation       1596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75334581"
     variation       1598
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771575517"
     variation       1602
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777064999"
     variation       1603
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1222485044"
     variation       1604
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746262560"
     variation       1608
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770091461"
     variation       1609
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775830036"
     variation       1616
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310638638"
     variation       1621
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1168555745"
     variation       1625
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356539356"
     variation       1626
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762909149"
     variation       1631..1634
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1232852759"
     variation       1631
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:892222231"
     variation       1634
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149664604"
     variation       1635..1639
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="accct"
                     /db_xref="dbSNP:1565244337"
     variation       1636
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145676536"
     variation       1637
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380677810"
     variation       1638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450281687"
     variation       1645
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11200386"
     variation       1646
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753581178"
     variation       1647
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591812724"
     variation       1654
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369132344"
     variation       1660
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315940344"
     variation       1662
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561985082"
     variation       1664
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752463508"
     variation       1665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:979196237"
     variation       1667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411146175"
     variation       1671
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236316324"
     variation       1672
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757836508"
     variation       1675
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172950099"
     variation       1679
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200528151"
     variation       1689
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148904467"
     variation       1690
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114762109"
     variation       1693
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781769275"
     variation       1702
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746211474"
     variation       1705
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147619126"
     variation       1707
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1241814497"
     variation       1708
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421904841"
     variation       1710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1033556936"
     variation       1714
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1410675699"
     variation       1716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1303839850"
     variation       1718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175638960"
     variation       1719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564223053"
     variation       1723
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591813245"
     variation       1724
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403935615"
     variation       1725
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780133425"
     variation       1727
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368410259"
     variation       1729
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227270289"
     variation       1730
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768766027"
     variation       1742
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429753324"
     variation       1744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192159808"
     variation       1750
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210835202"
     variation       1752
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566315747"
     variation       1753
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774452059"
     variation       1757
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761904658"
     variation       1758
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770836132"
     variation       1763
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1320750102"
     variation       1766
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:546635210"
     variation       1767
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:559696036"
     variation       1768
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446995731"
     variation       1769..1798
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gcacca"
                     /replace="gcaccaccccctcctcttcccaaggcacca"
                     /db_xref="dbSNP:1020613370"
     variation       1770
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202141378"
     variation       1772..1773
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:776272139"
     variation       1772
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765078280"
     variation       1775..1779
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:759133015"
     variation       1775
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1190786875"
     variation       1776
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528658002"
     variation       1777
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1427508227"
     variation       1778
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565245537"
     variation       1779
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752444601"
     variation       1788
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763681670"
     variation       1789
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751028297"
     variation       1793
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399973022"
     variation       1794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905028710"
     variation       1800
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756875792"
     variation       1802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346694624"
     variation       1806
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360885642"
     variation       1809
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178325419"
     variation       1818
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781755154"
     variation       1819
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565245806"
     variation       1821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142141564"
     variation       1822
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780400707"
     variation       1825
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224830351"
     variation       1829
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426922926"
     variation       1830..1831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="cg"
                     /db_xref="dbSNP:764501097"
     variation       1830
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:548635055"
     variation       1831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138675193"
     variation       1836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779053874"
     variation       1842
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201967564"
     variation       1843
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373604882"
     variation       1844
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772211415"
     variation       1847
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759414892"
     variation       1848
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375286554"
     variation       1849
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868130401"
     variation       1855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1200409000"
     variation       1856
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1411401726"
     variation       1858
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468646591"
     variation       1859
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775312857"
     variation       1862
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009483361"
     variation       1863
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762673854"
     variation       1867
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371437428"
     variation       1868
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565246362"
     variation       1870
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763776508"
     variation       1871
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774186572"
     variation       1874
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1220057312"
     variation       1880
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591814582"
     variation       1883
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761403864"
     variation       1884
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1318217606"
     variation       1885
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767192455"
     variation       1887
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303359837"
     variation       1890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749966059"
     variation       1892
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756650921"
     variation       1893
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868623666"
     variation       1897
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766819530"
     variation       1898
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412781477"
     variation       1899
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:967703549"
     variation       1900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303372202"
     variation       1903
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754208971"
     variation       1906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368976938"
     variation       1907
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779196180"
     variation       1909
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748429941"
     variation       1917
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1223564644"
     variation       1918
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758636102"
     variation       1921
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436181308"
     variation       1922
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777760422"
     variation       1923
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747119603"
     variation       1924
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769718707"
     variation       1926
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761911531"
     variation       1927
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565246940"
     variation       1940
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775335544"
     variation       1941
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7083776"
     variation       1943
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768402028"
     variation       1944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141860738"
     variation       1947
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761497503"
     variation       1951
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434869581"
     variation       1952
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766415523"
     variation       1954
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:555097355"
     variation       1957
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772802074"
     variation       1961
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149295961"
     variation       1963
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150192288"
     variation       1968
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452622441"
     variation       1975
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182927465"
     variation       1977
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754373092"
     variation       1979
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138676514"
     variation       1987
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1250989108"
     variation       1990
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758516019"
     variation       1993
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528483370"
     variation       1994
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765465926"
     variation       1997
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764011384"
     variation       1998
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758575064"
     variation       2000
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777989681"
     variation       2003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188032605"
     variation       2004
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757318734"
     variation       2008
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1323309835"
     variation       2011
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1372152237"
     variation       2022
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591815642"
     variation       2024
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460212228"
     variation       2030
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142251964"
     variation       2032
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371156233"
     variation       2033
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749239930"
     variation       2034
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768651010"
     variation       2037
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747979426"
     variation       2038
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771828660"
     variation       2040
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144525982"
     variation       2045
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026573145"
     variation       2046
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456664972"
     variation       2050
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950570245"
     variation       2053
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295214997"
     variation       2057
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760229129"
     variation       2059
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1484746783"
     variation       2060
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1165993129"
     variation       2061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770408995"
     variation       2063
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381715116"
     variation       2064..2076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ccagctcacactc"
                     /db_xref="dbSNP:774694320"
     variation       2068
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776222468"
     variation       2072
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759897081"
     variation       2075
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1261194202"
     variation       2077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591816082"
     variation       2078
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1462547161"
     variation       2080
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:535624704"
     variation       2081
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896311539"
     variation       2084
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489282823"
     variation       2088
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113893072"
     variation       2089
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964735729"
     variation       2090
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426494594"
     variation       2094
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763354809"
     variation       2097
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764266181"
     variation       2098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751794067"
     variation       2100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757345853"
     variation       2101
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591816362"
     variation       2102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311374362"
     variation       2105
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408943663"
     variation       2106
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467059301"
     variation       2110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288779126"
     variation       2112
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:60531929"
     variation       2113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384238466"
     variation       2114
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750519794"
     variation       2116
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372711396"
     variation       2117
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754824553"
     variation       2118
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393224247"
     variation       2122
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779042725"
     variation       2127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747923514"
     variation       2131
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1324359806"
     variation       2132
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359122985"
     variation       2133
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1233942408"
     variation       2134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772061605"
     variation       2140
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777557684"
     variation       2141
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1161001710"
     variation       2147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750786303"
     variation       2154
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565248544"
     variation       2158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12246656"
     variation       2159
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196194179"
     variation       2160
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267690614"
     variation       2162
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185645252"
     variation       2163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770626137"
     variation       2168
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490064597"
     variation       2170
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756674929"
     variation       2172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759104786"
     variation       2177
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770259437"
     variation       2184
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1166423895"
     variation       2185
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776015159"
     variation       2186
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867958572"
     variation       2189
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377480879"
     variation       2191
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1026545025"
     variation       2192
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1299114677"
     variation       2193
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764499001"
     variation       2194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751965125"
     variation       2195
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201122938"
     variation       2196
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750449339"
     variation       2198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756303366"
     variation       2200
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306226094"
     variation       2201
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778991503"
     variation       2202
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148637680"
     variation       2206
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780554760"
     variation       2207
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286552880"
     variation       2208
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300479885"
     variation       2209
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1420821296"
     variation       2210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199569835"
     variation       2212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:539975814"
     variation       2213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270547451"
     variation       2216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170290648"
     variation       2221
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746855730"
     variation       2229
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1467133093"
     variation       2230
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756807063"
     variation       2231
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142091094"
     variation       2240
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745336794"
     variation       2242
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371118062"
     variation       2243
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769357558"
     variation       2247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:775962093"
     variation       2248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749736471"
     variation       2249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1165738314"
     variation       2253
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1254004453"
     variation       2254
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769155262"
     variation       2260
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774538172"
     variation       2261
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762287107"
     variation       2266
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296455453"
     variation       2268
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767604128"
     variation       2270
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1448976430"
     variation       2271
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773552274"
     variation       2277
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760826192"
     variation       2279
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1401058971"
     variation       2280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766512610"
     variation       2281
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753974305"
     variation       2285
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758375668"
     variation       2286
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321880106"
     variation       2288
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764117878"
     variation       2289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1249174665"
     variation       2293
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751286519"
     variation       2294
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528706688"
     variation       2296
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151146332"
     variation       2297
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745575153"
     variation       2303
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1185749198"
     variation       2307
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755775293"
     variation       2309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373061354"
     variation       2311
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748828410"
     variation       2314
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917756850"
     variation       2316
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1026226062"
     variation       2317..2319
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:762431847"
     variation       2319
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769102037"
     variation       2320
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139001743"
     variation       2322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201768336"
     variation       2325
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1171042722"
     variation       2328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772547313"
     variation       2329
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773464003"
     variation       2333
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370133969"
     variation       2338
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:41288002"
     variation       2339
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1292960472"
     variation       2343
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201927666"
     variation       2346
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1319428254"
     variation       2350
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016075340"
     variation       2353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868288892"
     variation       2355
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537115035"
     variation       2363
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256931312"
     variation       2367
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759735357"
     variation       2368
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903795349"
     variation       2372
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1260237649"
     variation       2381..2383
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:35940982"
     variation       2381
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996224642"
     variation       2385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201625808"
     variation       2387
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:561185577"
     variation       2393
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756986623"
     variation       2394
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475275986"
     variation       2398
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356113781"
     variation       2403
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767283030"
     variation       2404
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889443017"
     variation       2405
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421860489"
     variation       2414
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570530902"
     variation       2418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1341641620"
     variation       2419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755723859"
     variation       2422
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779701973"
     variation       2427
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533321618"
     variation       2430
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754584500"
     variation       2431
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327584464"
     variation       2432
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370792706"
     variation       2434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359567691"
     variation       2437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546814637"
     variation       2438
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147635960"
     variation       2442
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401954590"
     variation       2443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341925893"
     variation       2445
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772464828"
     variation       2451
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201466757"
     variation       2452
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747403207"
     variation       2457
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374576101"
     variation       2459
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368073870"
     variation       2462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:192876235"
     variation       2465
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769972131"
     variation       2467
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775443867"
     variation       2468
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535338058"
     variation       2469
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767385508"
     variation       2470
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144398174"
     variation       2471
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760512466"
     variation       2474
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026886132"
     variation       2475
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174278529"
     variation       2476
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:569034512"
     variation       2477
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309190983"
     variation       2478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569744421"
     variation       2479
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145289539"
     variation       2487
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778422472"
     variation       2488
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752182627"
     variation       2490
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558056061"
     variation       2491
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747341872"
     variation       2493
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1437935983"
     variation       2496
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751950014"
     variation       2497
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350507702"
     variation       2499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149165465"
     variation       2501
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1229166880"
     variation       2503..2572
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tcatgctggggtgccacatcccccccagggggagaacttggcagcaga
                     cctggggctcacggcactcatc"
                     /replace="tcatgctggggtgccacatcccccccagggggagaacttggcagcaga
                     cctggggctcacggcactcatcatgctggggtgccacatcccccccagggggagaact
                     tggcagcagacctggggctcacggcactcatc"
                     /db_xref="dbSNP:1565251348"
     variation       2506
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781548516"
     variation       2510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577728559"
     variation       2512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769911320"
     variation       2520
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562599269"
     variation       2522..2528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:750901207"
     variation       2522
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762964320"
     variation       2523
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1277717545"
     variation       2524
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867214057"
     variation       2525
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199597673"
     variation       2526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773200885"
     variation       2527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370393890"
     variation       2528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048137249"
     variation       2529
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145103148"
     variation       2530..2534
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:756151149"
     variation       2530
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11597437"
     variation       2531
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759190818"
     variation       2532
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471985798"
     variation       2533
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370877791"
     variation       2536
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537034175"
     variation       2539
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406609251"
     variation       2540
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977973379"
     variation       2541
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553632378"
     variation       2543
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757503632"
     variation       2545
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373805946"
     variation       2554..2557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1312059846"
     variation       2554
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148302255"
     variation       2555
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200640597"
     variation       2556
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218202624"
     variation       2557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172333971"
     variation       2560
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757850175"
     variation       2562
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781633294"
     variation       2563
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746247635"
     variation       2564
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368496781"
     variation       2565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372856593"
     variation       2569
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74901704"
     variation       2572
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768782999"
     variation       2574
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201169518"
     variation       2577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145909090"
     variation       2578
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366494014"
     variation       2579
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954899233"
     variation       2586
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770888861"
     variation       2587
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395195880"
     variation       2592
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565252297"
     variation       2593
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407673514"
     variation       2597
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361153971"
     variation       2601
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159916934"
     variation       2603
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138475310"
     variation       2604
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401590237"
     variation       2607
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423270574"
     variation       2609..2612
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1174567037"
     variation       2609
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452375961"
     variation       2610
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147171017"
     variation       2611
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764915560"
     variation       2614
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245863074"
     variation       2621
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775075745"
     variation       2625
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489555792"
     variation       2626
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264542655"
     variation       2627
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337562560"
     variation       2630
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762507712"
     variation       2633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1259927483"
     variation       2634
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968963111"
     variation       2635
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763636597"
     variation       2638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746017280"
     variation       2639
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150668512"
     variation       2640
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768159687"
     variation       2642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750776742"
     variation       2643
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958859981"
     variation       2644
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274025678"
     variation       2645
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1372095023"
     variation       2648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476563960"
     variation       2650
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345458637"
     variation       2653
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172111754"
     variation       2657
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591821131"
     variation       2666
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756474425"
     variation       2669
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10887063"
     variation       2671
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1335291450"
     variation       2673
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887908913"
     variation       2675
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404849634"
     variation       2676
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396930945"
     variation       2680
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749414532"
     variation       2686
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778926377"
     variation       2690
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564421543"
     variation       2694
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770835948"
     variation       2696
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776477606"
     variation       2697
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745676113"
     variation       2698
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377277808"
     variation       2700
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775365809"
     variation       2709
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762625092"
     variation       2710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368173512"
     variation       2711
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773947901"
     variation       2714
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761456928"
     variation       2715
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768037393"
     variation       2716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750959270"
     variation       2718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761259077"
     variation       2720
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766587352"
     variation       2721
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379825254"
     variation       2724
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140280635"
     variation       2726
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244079867"
     variation       2727
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210280761"
     variation       2728
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142075625"
     variation       2729
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779158034"
     variation       2732
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752746017"
     variation       2736
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758543512"
     variation       2737
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781180184"
     variation       2739..2742
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:766506682"
     variation       2743
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149275566"
     variation       2746
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371996281"
     variation       2749
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047409790"
     variation       2751
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779670767"
     variation       2754
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529398984"
     variation       2761..2762
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:747873325"
     variation       2761
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376114582"
     variation       2764
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774186447"
     variation       2766
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381326737"
     variation       2779
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1286029248"
     variation       2780
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490048887"
     variation       2781
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761403994"
     variation       2788..2789
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tttg"
                     /db_xref="dbSNP:754168852"
     variation       2790..2791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:755243171"
     variation       2796
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270100081"
     variation       2800
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771425196"
     variation       2801
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772782385"
     variation       2804
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197805195"
     variation       2806
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144481289"
     variation       2809
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151325176"
     variation       2811
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355443115"
     variation       2813
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1159498466"
     variation       2820
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569094533"
     variation       2821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456461298"
     variation       2831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565254036"
     variation       2832
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037615068"
     variation       2836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41288004"
     variation       2838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183592859"
     variation       2839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261968519"
     variation       2843
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996005967"
     variation       2845
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765438006"
     variation       2847
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369401230"
     variation       2850
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759349202"
     variation       2852
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241981531"
     variation       2856
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565254265"
     variation       2857
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371747734"
     variation       2858
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1358197808"
     variation       2863
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375029779"
     variation       2867
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751695214"
     variation       2873
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1323367095"
     variation       2874
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488505476"
     variation       2876
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369006789"
     variation       2881
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780090188"
     variation       2887
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441945248"
     variation       2888
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179579358"
     variation       2897
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768639717"
     variation       2901
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422347239"
     variation       2904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558111165"
     variation       2908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565254553"
     variation       2914
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1376290288"
     variation       2919
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307223842"
     variation       2923
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1350579736"
     variation       2925
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1449245390"
     variation       2926
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1461510287"
     variation       2935
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747735733"
     variation       2941
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571515128"
     variation       2942
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772546309"
     variation       2944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309792473"
     variation       2945
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771308641"
     variation       2950
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777186376"
     variation       2952
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591823150"
     variation       2958
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048579150"
     variation       2960
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377924349"
     variation       2962
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759877044"
     variation       2965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020247194"
     variation       2979
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533590866"
     variation       2980
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765524349"
     variation       2981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:117734649"
     variation       2991
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573509371"
     variation       2992
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751566772"
     variation       2993
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751571229"
     variation       2997
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489355712"
     variation       2998
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265915063"
     variation       3000
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140606887"
     variation       3004
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183848172"
     variation       3006
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351481349"
     variation       3010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1025016213"
     variation       3013
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283952053"
     variation       3016
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428005203"
     variation       3017
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168535545"
     variation       3019
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766415831"
     variation       3023
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142194146"
     variation       3024
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331920239"
     variation       3028
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999620785"
     variation       3032
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151198040"
     variation       3033
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747977383"
     variation       3038
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304184250"
     variation       3040
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774454610"
     variation       3041
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777520041"
     variation       3042
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1024869016"
     variation       3048
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353645806"
     variation       3051..3124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ag"
                     /replace="agtcctcgagggtctcgcctccagcagcagatgtcttaaaagactttt
                     ctcttgcagggaacttcagcagaaag"
                     /db_xref="dbSNP:1565255515"
     variation       3051
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:970505269"
     variation       3052
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746493115"
     variation       3057
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275823352"
     variation       3058
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373322084"
     variation       3060
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112188313"
     variation       3061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1278485981"
     variation       3062
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376454944"
     variation       3065
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212614772"
     variation       3066
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770320810"
     variation       3067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149803621"
     variation       3069
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191759613"
     variation       3071
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973342664"
     variation       3072
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:567308602"
     variation       3074
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265484100"
     variation       3079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231310372"
     variation       3081
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764193740"
     variation       3084
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171330269"
     variation       3087
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591824234"
     variation       3092
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1424310114"
     variation       3093
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774703041"
     variation       3094
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931864180"
     variation       3095..3098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1178047854"
     variation       3096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767648184"
     variation       3099
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1399066665"
     variation       3102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051623851"
     variation       3104
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591824437"
     variation       3108
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341866497"
     variation       3109
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750562778"
     variation       3110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1300617331"
     variation       3112
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274789510"
     variation       3118
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145748763"
     variation       3119
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765313097"
     variation       3124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171043621"
     variation       3127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1279848159"
     variation       3140
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140641088"
     variation       3143
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758278410"
     variation       3144
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457489734"
     variation       3145..3148
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1288371627"
     variation       3146
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1488668121"
     variation       3147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777275006"
     variation       3150
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1245051891"
     variation       3154
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477034011"
     variation       3155
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:904553223"
     variation       3156
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746610603"
     variation       3159
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756903499"
     variation       3163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780242938"
     variation       3164
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1034283140"
     variation       3168
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369386229"
     variation       3172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361997969"
     variation       3175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1419777555"
     variation       3180
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754393114"
     variation       3184
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318279705"
     variation       3191
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776019343"
     variation       3192
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749612529"
     variation       3195
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:531738196"
     variation       3198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533671771"
     variation       3201
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762054534"
     variation       3202
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540533028"
     variation       3203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354777334"
     variation       3205
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773402221"
     variation       3208
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364273844"
     variation       3209
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1435639179"
     variation       3210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ccc"
                     /db_xref="dbSNP:1287880074"
     variation       3211
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264008470"
     variation       3212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150064065"
     variation       3217
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316483501"
     variation       3222
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765258038"
     variation       3225
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253492659"
     variation       3230
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115790843"
     variation       3233
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902532640"
     variation       3245
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:999906345"
     variation       3246
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762808866"
     variation       3247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162257930"
     variation       3249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014664526"
     variation       3252
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963069615"
     variation       3253
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406554177"
     variation       3255..3258
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:778887227"
     variation       3256
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751345990"
     variation       3257
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445209818"
     variation       3259
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:893907659"
     variation       3262
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378087580"
     variation       3268
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756858369"
     variation       3270
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282606971"
     variation       3271
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780875270"
     variation       3273
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228901996"
     variation       3281
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61753073"
     variation       3285
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457310713"
     variation       3286
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375580409"
     variation       3291
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239830123"
     variation       3294
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780412768"
     variation       3295
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762157882"
     variation       3296
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562955567"
     variation       3298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473497381"
     variation       3300
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165099565"
     variation       3302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769048028"
     variation       3305
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779288189"
     variation       3309..3312
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cc"
                     /replace="cccc"
                     /db_xref="dbSNP:747878043"
     variation       3309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748510179"
     variation       3310
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366653303"
     variation       3314
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267826947"
     variation       3315
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143377886"
     variation       3322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773633306"
     variation       3323
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342415729"
     variation       3327
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:760822277"
     variation       3336
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201895792"
     variation       3338
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565257724"
     variation       3340
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591826266"
     variation       3342
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277711233"
     variation       3349
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200089998"
     variation       3354
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316120571"
     variation       3361
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1216763677"
     variation       3362
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771074320"
     variation       3363
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1339848997"
     variation       3365
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591826436"
     variation       3366
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776575219"
     variation       3367
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253813524"
     variation       3372
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762904530"
     variation       3373
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936063133"
     variation       3374
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1261892627"
     variation       3376
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763964610"
     variation       3377
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11200387"
     variation       3383
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307948299"
     variation       3385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373281844"
     variation       3386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377162544"
     variation       3393
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767703999"
     variation       3395
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1171256609"
     variation       3400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750135495"
     variation       3403
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755777292"
     variation       3406
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779550947"
     variation       3408..3411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1329222322"
     variation       3410
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753310888"
     variation       3412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401867935"
     variation       3413
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388431014"
     variation       3416
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280024053"
     variation       3418..3421
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:758166315"
     variation       3419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755488831"
     variation       3425
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951314455"
     variation       3430
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1254082078"
     variation       3434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591827046"
     variation       3436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779326266"
     variation       3437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385921928"
     variation       3440
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748517134"
     variation       3445
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:547344614"
     variation       3448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747157686"
     variation       3449
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178167076"
     variation       3452
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1438054962"
     variation       3455
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1046402183"
     variation       3456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:887306452"
     variation       3462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771085934"
     variation       3463
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1261805424"
     variation       3465
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776727702"
     variation       3466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745988155"
     variation       3467
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197343035"
     variation       3468
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768609936"
     variation       3469
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41288006"
     variation       3470
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761583861"
     variation       3471
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199691186"
     variation       3472
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772996349"
     variation       3474
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:937118499"
     variation       3475
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746589548"
     variation       3478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289579921"
     variation       3480
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:58421538"
     variation       3481
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753356833"
     variation       3488
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:7073433"
     variation       3489
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765760444"
     variation       3490
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591827641"
     variation       3496
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953156616"
     variation       3498
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753194129"
     variation       3499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143465172"
     variation       3502
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778239169"
     variation       3503
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374246191"
     variation       3509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1046697933"
     variation       3511
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210936430"
     variation       3514
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1260850232"
     variation       3515
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757482922"
     variation       3516
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781313118"
     variation       3527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254677297"
     variation       3528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745958023"
     variation       3533
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1270033021"
     variation       3534
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769825628"
     variation       3539
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:967290744"
     variation       3541
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775561709"
     variation       3542
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147140774"
     variation       3544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378842106"
     variation       3545
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977241449"
     variation       3547
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1441829059"
     variation       3549
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925749060"
     variation       3551
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748012977"
     variation       3554
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477845250"
     variation       3555
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201283222"
     variation       3559
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772967952"
     variation       3562
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140254775"
     variation       3563
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377358487"
     variation       3565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471657765"
     variation       3566
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370359361"
     variation       3572
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759236435"
     variation       3586
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764582325"
     variation       3587
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200785553"
     variation       3590
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307214920"
     variation       3592
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591828416"
     variation       3594
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218259462"
     variation       3595
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758923315"
     variation       3596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764750855"
     variation       3597
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751945438"
     variation       3599
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566377148"
     variation       3601
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591828534"
     variation       3604
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776235670"
     variation       3606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198546831"
     variation       3618
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236776851"
     variation       3621
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141360696"
     variation       3622
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145035433"
     variation       3624
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756365382"
     variation       3626
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780069470"
     variation       3629
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167084166"
     variation       3630
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418645005"
     variation       3638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461935934"
     variation       3639
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138892486"
     variation       3648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368649119"
     variation       3649
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958360797"
     variation       3655
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777754404"
     variation       3656
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:898633554"
     variation       3660
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372405430"
     variation       3662
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867711974"
     variation       3667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770572757"
     variation       3671
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294650888"
     variation       3672
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776487415"
     variation       3674
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759068587"
     variation       3682
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560590906"
     variation       3684
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320462719"
     variation       3685
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775114861"
     variation       3686
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762596354"
     variation       3689
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764697787"
     variation       3691
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:574013647"
     variation       3694
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:543039628"
     variation       3695
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1477513653"
     variation       3696
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750833650"
     variation       3701
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1421316772"
     variation       3704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476704358"
     variation       3708
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411452249"
     variation       3710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563010428"
     variation       3713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780294751"
     variation       3714
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1565260344"
     variation       3714
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531851854"
     variation       3716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755107116"
     variation       3723
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778975786"
     variation       3729
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61756213"
     variation       3730
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306914341"
     variation       3731
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350703229"
     variation       3732
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971124190"
     variation       3739
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148462201"
     variation       3740
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276863653"
     variation       3742
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008991896"
     variation       3744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766394403"
     variation       3746
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374367001"
     variation       3751
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215651323"
     variation       3754
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780796802"
     variation       3755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367931147"
     variation       3757
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769543302"
     variation       3763
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142607481"
     variation       3767
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369885153"
     variation       3768
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565260715"
     variation       3769
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488011536"
     variation       3771
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214458563"
     variation       3772
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265420094"
     variation       3777
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270778148"
     variation       3780
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447410451"
     variation       3781
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768227014"
     variation       3783
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548512736"
     variation       3784
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:777605657"
     variation       3788
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371617188"
     variation       3789
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054002665"
     variation       3799
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175145407"
     variation       3802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762187942"
     variation       3803
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400001164"
     variation       3806
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418714196"
     variation       3807
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1295868539"
     variation       3815
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168855098"
     variation       3816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768092599"
     variation       3818
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432154804"
     variation       3820
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750732161"
     variation       3821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761093325"
     variation       3822
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753999926"
     variation       3825
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146828853"
     variation       3830
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374980249"
     variation       3831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:991612701"
     variation       3832
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1238220937"
     variation       3836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1286480068"
     variation       3838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457079141"
     variation       3839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139627182"
     variation       3846
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757115668"
     variation       3847
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527457428"
     variation       3860
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781226978"
     variation       3863
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1189702146"
     variation       3869
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289090553"
     variation       3872
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227774437"
     variation       3876
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745649340"
     variation       3877
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756035009"
     variation       3878
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046167542"
     variation       3880
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780010998"
     variation       3883
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908501483"
     variation       3886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432408089"
     variation       3887..3894
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="ccttacct"
                     /db_xref="dbSNP:1400731544"
     variation       3887
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323492044"
     variation       3895
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348578371"
     variation       3896
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1453643537"
     variation       3901
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748886768"
     variation       3902
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368826592"
     variation       3904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:570203372"
     variation       3905
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238286947"
     variation       3907
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772452609"
     variation       3913
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773826102"
     variation       3914
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547702577"
     variation       3918
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423336814"
     variation       3919
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144252123"
     variation       3920
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332665353"
     variation       3921
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549308243"
     variation       3923
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867691226"
     variation       3925
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253433266"
     variation       3938
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777008551"
     variation       3940
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759701337"
     variation       3942
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234196865"
     variation       3944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765543263"
     variation       3946
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752685625"
     variation       3947
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758573870"
     variation       3954
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463512860"
     variation       3955
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146552537"
     variation       3956
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178675975"
     variation       3961
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400059184"
     variation       3962
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443838890"
     variation       3963
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750322048"
     variation       3964
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932790809"
     variation       3967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756129607"
     variation       3973
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361579585"
     variation       3976
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189703796"
     variation       3977
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141191344"
     variation       3981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778669774"
     variation       3985
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305156438"
     variation       3986
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387737473"
     variation       3990
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357409799"
     variation       3992
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140508731"
     variation       3994
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375356735"
     variation       3998
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867158937"
     variation       4001
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1273678963"
     variation       4003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1317079427"
     variation       4005
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771550397"
     variation       4007
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1274850801"
     variation       4011
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438103579"
     variation       4014
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186372970"
     variation       4015
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757619080"
     variation       4022
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1475874537"
     variation       4023
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145858416"
     variation       4026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160800878"
     variation       4028
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747473505"
     variation       4029
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771446927"
     variation       4031
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201269542"
     variation       4035
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1424186719"
     variation       4037
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759931970"
     variation       4043
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414163684"
     variation       4048
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1332385929"
     variation       4054
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368864486"
     variation       4055
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371332642"
     variation       4056..4061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:1565262628"
     variation       4056
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763099889"
     variation       4057
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293834161"
     variation       4058
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764172737"
     variation       4059
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1225136693"
     variation       4060
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148992015"
     variation       4062
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766468837"
     variation       4063
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1106992"
     variation       4064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200389636"
     variation       4071
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754870626"
     variation       4072
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778583843"
     variation       4074
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211066156"
     variation       4077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347887090"
     variation       4080
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032873351"
     variation       4087
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752326690"
     variation       4088
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866265498"
     variation       4093
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138440519"
     variation       4098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195920400"
     variation       4099
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777284379"
     variation       4103
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:77722854"
     variation       4107
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565263029"
     variation       4108
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172019785"
     variation       4113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1290174956"
     variation       4119
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:578136211"
     variation       4121..4123
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:746900532"
     variation       4121
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746220751"
     variation       4124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591832748"
     variation       4127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145835442"
     variation       4128
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763198415"
     variation       4132
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1320152000"
     variation       4134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990151098"
     variation       4138
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591832864"
     variation       4142
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143678523"
     variation       4144
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774550802"
     variation       4145
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762026579"
     variation       4146
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766415869"
     variation       4149
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754121824"
     variation       4155
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1259728976"
     variation       4156
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207040450"
     variation       4158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284744082"
     variation       4159
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484586855"
     variation       4160
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565263457"
     variation       4161
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753769021"
     variation       4162
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199771319"
     variation       4166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759394267"
     variation       4172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574376849"
     variation       4173
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908580173"
     variation       4179
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397253374"
     variation       4190
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755573981"
     variation       4199
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1218546185"
     variation       4200
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158239667"
     variation       4202
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752456833"
     variation       4203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1348904647"
     variation       4205
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940003180"
     variation       4207
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1325271548"
     variation       4210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297011162"
     variation       4214
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777439307"
     variation       4216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2420984"
     variation       4222
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1160232595"
     variation       4225
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385667245"
     variation       4226
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141137444"
     variation       4228
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756815559"
     variation       4232
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372874231"
     variation       4236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201403636"
     variation       4239
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746310341"
     variation       4244
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1314623696"
     variation       4249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2420985"
     variation       4259
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1240476299"
     variation       4260
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260795730"
     variation       4261
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356331011"
     variation       4265
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150806548"
     variation       4266
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2420986"
     variation       4267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047104634"
     variation       4271
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:562873954"
     variation       4273
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2901300"
     variation       4275
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768892142"
     variation       4279
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774783738"
     variation       4282
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761973358"
     variation       4284
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591833894"
     variation       4286
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772210885"
     variation       4289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773457153"
     variation       4296
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139193688"
     variation       4299
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149524584"
     variation       4300
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146003266"
     variation       4301
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1242652108"
     variation       4304
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139901847"
     variation       4306
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375410376"
     variation       4309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370022515"
     variation       4314
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766977575"
     variation       4320
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:906834461"
     variation       4328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999028066"
     variation       4338
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749926931"
     variation       4345
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61753074"
     variation       4349
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373598465"
     variation       4356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148089397"
     variation       4358
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73370132"
     variation       4362
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591834362"
     variation       4373
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198489283"
     variation       4374..4376
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1383160609"
     variation       4375
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142268660"
     variation       4377
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748339041"
     variation       4378
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753197990"
     variation       4379
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565264695"
     variation       4381
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:561278421"
     variation       4382
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591834582"
     variation       4383
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747095730"
     variation       4385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591834626"
     variation       4387
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168394869"
     variation       4388
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529950167"
     variation       4394
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775345822"
     variation       4396
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762957952"
     variation       4407
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012797762"
     variation       4411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763813576"
     variation       4412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565264873"
     variation       4415
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1446598277"
     variation       4417
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549620504"
     variation       4418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201709460"
     variation       4423
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1253159637"
     variation       4428
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767210325"
     variation       4429
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186111089"
     variation       4430
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766896829"
     variation       4442
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754242356"
     variation       4444
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755571334"
     variation       4445
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214475865"
     variation       4446
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151338600"
     variation       4448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756835346"
     variation       4450
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359637058"
     variation       4453
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278614134"
     variation       4454
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4752642"
     variation       4458
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758659101"
     variation       4460
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255573458"
     variation       4473
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777920896"
     variation       4475
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747095409"
     variation       4477
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369857658"
     variation       4481
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1386136050"
     variation       4487
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776779050"
     variation       4488
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749187326"
     variation       4491..4508
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ca"
                     /replace="cagtgggtaaagacctca"
                     /db_xref="dbSNP:770443389"
     variation       4491
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1430031081"
     variation       4492
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166667485"
     variation       4494
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768607283"
     variation       4503
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591835383"
     variation       4505
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1394172349"
     variation       4507
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301305433"
     variation       4509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432466986"
     variation       4510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774114513"
     variation       4513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147103470"
     variation       4514
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430685678"
     variation       4516
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1199708536"
     variation       4517
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147723400"
     variation       4520
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772799623"
     variation       4526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867470186"
     variation       4528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745640843"
     variation       4531
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765765099"
     variation       4534
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1346058715"
     variation       4535
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347443826"
     variation       4547
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236740359"
     variation       4561
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554079517"
     variation       4564
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948626847"
     variation       4565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760096865"
     variation       4570
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765884417"
     variation       4571
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752256733"
     variation       4575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758887730"
     variation       4577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567812975"
     variation       4579
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1224010366"
     variation       4580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372773858"
     variation       4583
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1283002232"
     variation       4586
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757532639"
     variation       4587
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142508761"
     variation       4589
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1352479260"
     variation       4589
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745999458"
     variation       4599..4606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="agaag"
                     /replace="agaagaag"
                     /db_xref="dbSNP:1399558971"
     variation       4602
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157568359"
     variation       4606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031734588"
     variation       4610
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145895228"
     variation       4622
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778889567"
     variation       4625
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747926543"
     variation       4628
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369192418"
     variation       4630
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443418196"
     variation       4635
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771707264"
     variation       4637
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773065628"
     variation       4643
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760195137"
     variation       4644
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138712565"
     variation       4646
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775971633"
     variation       4647
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377557246"
     variation       4649
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765823262"
     variation       4651
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4751871"
     variation       4652
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201384640"
     variation       4654
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143443054"
     variation       4655
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751979400"
     variation       4656
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7920896"
     variation       4662
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781520600"
     variation       4663
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750498409"
     variation       4669
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164787944"
     variation       4670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236328663"
     variation       4673
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756245611"
     variation       4674
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1463290783"
     variation       4681
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780122291"
     variation       4685
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748013331"
     variation       4687
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054052519"
     variation       4690
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777406394"
     variation       4692
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746859836"
     variation       4694
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374096374"
     variation       4697
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770484899"
     variation       4698
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776476408"
     variation       4700
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201773248"
     variation       4701
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141796592"
     variation       4702
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1290319071"
     variation       4705
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436918556"
     variation       4708
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201971567"
     variation       4709
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763323058"
     variation       4710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764713772"
     variation       4713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907056248"
     variation       4715
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774552350"
     variation       4716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762309480"
     variation       4717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146023378"
     variation       4718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750586655"
     variation       4723
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756335605"
     variation       4726
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408461199"
     variation       4734
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753966616"
     variation       4738
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1355196565"
     variation       4740
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556256653"
     variation       4741
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:908534813"
     variation       4744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1291502888"
     variation       4749
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777833001"
     variation       4752
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746766875"
     variation       4754
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139933944"
     variation       4756
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781135664"
     variation       4758
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745475032"
     variation       4759
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769594745"
     variation       4761
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775121013"
     variation       4765
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374990835"
     variation       4766
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769043605"
     variation       4769
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995555590"
     variation       4770..4771
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:763510151"
     variation       4772
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254746211"
     variation       4775
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774980994"
     variation       4777
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591837505"
     variation       4779
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188803824"
     variation       4782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1372890834"
     variation       4788..4799
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cagcctggccag"
                     /replace="cagcctggccagcctggccag"
                     /db_xref="dbSNP:776107296"
     variation       4788
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77105181"
     variation       4790..4811
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gcc"
                     /replace="gcctggccaggcctggaaggcc"
                     /db_xref="dbSNP:1419438243"
     variation       4791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767804940"
     variation       4795
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476124663"
     variation       4797
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146103943"
     variation       4799
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766627580"
     variation       4801
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565267535"
     variation       4803
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753857053"
     variation       4804
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139774351"
     variation       4811
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182569065"
     variation       4812
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334686941"
     variation       4815
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765242232"
     variation       4816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751443504"
     variation       4819
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1359762986"
     variation       4821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757170587"
     variation       4826
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781082579"
     variation       4828
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866903091"
     variation       4829
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745709267"
     variation       4831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755799027"
     variation       4832
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591838007"
     variation       4833
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277611573"
     variation       4834
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349352760"
     variation       4835
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779920795"
     variation       4839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1204067284"
     variation       4840
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:978249761"
     variation       4844
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:267602391"
     variation       4850
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195847316"
     variation       4852
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249015665"
     variation       4856
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231212957"
     variation       4859
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454032760"
     variation       4864
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748735038"
     variation       4866
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768158400"
     variation       4867
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591838252"
     variation       4868
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1306298193"
     variation       4869
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141300976"
     variation       4870
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1173096798"
     variation       4875
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748652112"
     variation       4879
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380445959"
     variation       4880
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773532416"
     variation       4885
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761091161"
     variation       4886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591838441"
     variation       4890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1439735004"
     variation       4899
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300731857"
     variation       4900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771124301"
     variation       4903
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565268191"
     variation       4904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233421657"
     variation       4908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144683166"
     variation       4912
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377713529"
     variation       4916
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934420612"
     variation       4925
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765318801"
     variation       4926
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1269200737"
     variation       4927
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380859050"
     variation       4929
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543590504"
     variation       4933
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752740775"
     variation       4938
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200004584"
     variation       4939
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052820093"
     variation       4941
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054127152"
     variation       4943
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767605167"
     variation       4945
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543328111"
     variation       4946
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77475605"
     variation       4950
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200979254"
     variation       4954
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1451583365"
     variation       4958
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754620520"
     variation       4959
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217362839"
     variation       4964
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375588375"
     variation       4966
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747649758"
     variation       4971
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323638092"
     variation       4974
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772560162"
     variation       4975
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778307131"
     variation       4976
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747524473"
     variation       4978
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333441263"
     variation       4981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241838025"
     variation       4982
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289465351"
     variation       4986
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368266470"
     variation       4995
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:900024723"
     variation       4996
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776890649"
     variation       4999
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002749520"
     variation       5000
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372471760"
     variation       5002
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591839335"
     variation       5004
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769956931"
     variation       5006
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1195403704"
     variation       5009
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248537428"
     variation       5010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148498917"
     variation       5011
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763193413"
     variation       5012
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199669973"
     variation       5018
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412699462"
     variation       5019
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200211980"
     variation       5022
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150804431"
     variation       5025
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482522779"
     variation       5026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11599291"
     variation       5027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199665884"
     variation       5030
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111241981"
     variation       5038
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368179089"
     variation       5041
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200645473"
     variation       5047
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556922327"
     variation       5048
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777266081"
     variation       5050
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371295390"
     variation       5052
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1020010097"
     variation       5055
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544094906"
     variation       5056
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199785683"
     variation       5059
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322645991"
     variation       5061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781596141"
     variation       5062
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746260034"
     variation       5067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770052058"
     variation       5073
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:180675951"
     variation       5074
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749535629"
     variation       5076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591840039"
     variation       5078
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485324981"
     variation       5079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294100754"
     variation       5082
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768793077"
     variation       5090
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201869943"
     variation       5093
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760644346"
     variation       5095
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169319366"
     variation       5096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:866334081"
     variation       5097
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766278349"
     variation       5098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916025093"
     variation       5103
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202019397"
     variation       5107..5110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1413495846"
     variation       5112
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989883649"
     variation       5120
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147738883"
     variation       5121
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380355451"
     variation       5124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75029377"
     variation       5126
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765089820"
     variation       5130
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866837240"
     variation       5138
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981312019"
     variation       5141
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1293861577"
     variation       5143
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368771136"
     variation       5145
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758076925"
     variation       5146
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200150846"
     variation       5150
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751117812"
     variation       5152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757749357"
     variation       5154
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781617648"
     variation       5155
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160958106"
     variation       5156
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746232229"
     variation       5157
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1472813513"
     variation       5160..5161
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1555016395"
     variation       5161..5162
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="gtgaa"
                     /db_xref="dbSNP:745587557"
     variation       5161
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565270027"
     variation       5161
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="ggtgaaagtg"
                     /db_xref="dbSNP:1428381008"
     variation       5163..5164
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tgac"
                     /db_xref="dbSNP:769406458"
     variation       5163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372221128"
     variation       5165
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756376309"
     variation       5166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450988527"
     variation       5167
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142571035"
     variation       5168
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144811256"
     variation       5169
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432249770"
     variation       5172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1177597442"
     variation       5180
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151181216"
     variation       5181
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453644337"
     variation       5182
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376774303"
     variation       5189
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774554714"
     variation       5194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436123022"
     variation       5195
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748281753"
     variation       5196
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140209193"
     variation       5202
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150315044"
     variation       5206
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931120775"
     variation       5207
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137931842"
     variation       5209
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565270503"
     variation       5212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369479336"
     variation       5219
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591841242"
     variation       5221
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138082360"
     variation       5222
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775285828"
     variation       5226..5233
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cacca"
                     /replace="caccacca"
                     /db_xref="dbSNP:775159083"
     variation       5226
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762572247"
     variation       5227
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374266799"
     variation       5228
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:995530793"
     variation       5229
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751066749"
     variation       5236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591841425"
     variation       5237
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192474180"
     variation       5244
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756776332"
     variation       5247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376809823"
     variation       5248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750828385"
     variation       5255
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756680474"
     variation       5256
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780520493"
     variation       5258
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755222761"
     variation       5260
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428031738"
     variation       5263
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392632922"
     variation       5264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779332914"
     variation       5267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190731334"
     variation       5271
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465562338"
     variation       5272
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748413057"
     variation       5273
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143666237"
     variation       5274
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591841785"
     variation       5276
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138754206"
     variation       5281
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141796876"
     variation       5282
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:560783379"
     variation       5286
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762801574"
     variation       5289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768285955"
     variation       5295
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1227393008"
     variation       5296
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272284472"
     variation       5302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591841970"
     variation       5310
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295343423"
     variation       5316
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200641398"
     variation       5319
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1031208223"
     variation       5321
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773937174"
     variation       5327..5331
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aca"
                     /replace="acaca"
                     /db_xref="dbSNP:762114377"
     variation       5328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761531246"
     variation       5333
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988756335"
     variation       5335
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175995091"
     variation       5337..5342
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gt"
                     /replace="gtgcgt"
                     /db_xref="dbSNP:1297167918"
     variation       5338
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766898906"
     variation       5340
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546030508"
     variation       5341
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1565271574"
     variation       5341
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164719489"
     variation       5344
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116907408"
     variation       5345
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753286281"
     variation       5349
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324394874"
     variation       5353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754253084"
     variation       5354
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755333219"
     variation       5356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309919536"
     variation       5360
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528054480"
     variation       5371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752818434"
     variation       5376
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933078892"
     variation       5377
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758665794"
     variation       5378
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777691521"
     variation       5380
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747152605"
     variation       5383
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769712352"
     variation       5384
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749238677"
     variation       5387
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774233662"
     variation       5388
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779970534"
     variation       5390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253321445"
     variation       5394
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444456360"
     variation       5395
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200419452"
     variation       5396
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187809613"
     variation       5397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771810058"
     variation       5398
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772568688"
     variation       5412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760302647"
     variation       5415
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746787282"
     variation       5416
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:969849286"
     variation       5423
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760147773"
     variation       5424
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591842939"
     variation       5425
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980247617"
     variation       5427
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1276066462"
     variation       5428
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:928345161"
     variation       5429
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371194782"
     variation       5430
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758921659"
     variation       5433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765645451"
     variation       5434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312134244"
     variation       5436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338494040"
     variation       5438
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148022903"
     variation       5440
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:995750903"
     variation       5444
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022979827"
     variation       5446
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758517700"
     variation       5448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764442622"
     variation       5449
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548012482"
     variation       5451
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002974128"
     variation       5453
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757271399"
     variation       5455..5456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1210815864"
     variation       5458
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918515169"
     variation       5462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956135133"
     variation       5463
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444621227"
     variation       5465
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188741221"
     variation       5466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1365079685"
     variation       5468
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1241859943"
     variation       5470
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561741785"
     variation       5473
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749183444"
     variation       5474
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390878349"
     variation       5475
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434105447"
     variation       5484
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754931537"
     variation       5487
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778553198"
     variation       5492
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748018931"
     variation       5494
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771621338"
     variation       5495..5498
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1417788599"
     variation       5495
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772979275"
     variation       5504
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165939944"
     variation       5509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432477123"
     variation       5510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746661006"
     variation       5520
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365302633"
     variation       5521
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10788237"
     variation       5524
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550387151"
     variation       5525
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760094555"
     variation       5527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289024778"
     variation       5528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369320771"
     variation       5529
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763431049"
     variation       5530
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764378043"
     variation       5533
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751738477"
     variation       5536
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570225185"
     variation       5537
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371867918"
     variation       5538
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1453984019"
     variation       5543
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767537356"
     variation       5544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:865868863"
     variation       5545
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754883354"
     variation       5546
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1404307778"
     variation       5551
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974597241"
     variation       5555
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778978597"
     variation       5557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747884557"
     variation       5559
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455386109"
     variation       5560
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758141860"
     variation       5561
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777458270"
     variation       5563
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746607621"
     variation       5565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391736896"
     variation       5568
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158306556"
     variation       5569
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591844481"
     variation       5571
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770753371"
     variation       5578
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1452127900"
     variation       5579
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298596702"
     variation       5580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332267749"
     variation       5584
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773442499"
     variation       5585
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199828025"
     variation       5587
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1183510976"
     variation       5591
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480430073"
     variation       5593
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372170043"
     variation       5594
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776005771"
     variation       5598
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763376130"
     variation       5599..5600
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tttttt"
                     /db_xref="dbSNP:1468240223"
     variation       5599
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565273580"
     variation       5602..5603
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="gc"
                     /db_xref="dbSNP:1208252788"
     variation       5602
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1269586490"
     variation       5604
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1452193932"
     variation       5606..5609
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="caac"
                     /db_xref="dbSNP:1199498594"
     variation       5612
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751080448"
     variation       5613
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471555540"
     variation       5614
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764481500"
     variation       5616
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1268591751"
     variation       5617..5620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tcca"
                     /db_xref="dbSNP:1412383344"
     variation       5618
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147160195"
     variation       5620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1338194433"
     variation       5622..5623
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:1291367775"
     variation       5623..5624
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:1392263758"
     variation       5627
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762000937"
     variation       5629
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306861270"
     variation       5630
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349239193"
     variation       5633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376248779"
     variation       5636..5641
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ga"
                     /replace="gacaga"
                     /db_xref="dbSNP:1331861033"
     variation       5639
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1317871693"
     variation       5639
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760804922"
     variation       5648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1412254309"
     variation       5649
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309108496"
     variation       5653
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378910055"
     variation       5656
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394724212"
     variation       5657
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:984093274"
     variation       5659
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315259638"
     variation       5661
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429659366"
     variation       5665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376075858"
     variation       5666
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760835902"
     variation       5667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161105358"
     variation       5670..5674
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tacct"
                     /replace="tacctacct"
                     /db_xref="dbSNP:1457646127"
     variation       5673
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1471761519"
     variation       5676
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766430639"
     variation       5677
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563753676"
     variation       5678
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762912856"
     variation       5681
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764003429"
     variation       5689
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751385080"
     variation       5690
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1179951126"
     variation       5691
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191981810"
     variation       5693
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976991720"
     variation       5694
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954821404"
     variation       5696
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1187493690"
     variation       5699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387797360"
     variation       5700
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008778698"
     variation       5702
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370448226"
     variation       5703
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781137814"
     variation       5705
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139266734"
     variation       5706
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1464955271"
     variation       5707
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755745408"
     variation       5712
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779595950"
     variation       5716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748790404"
     variation       5719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1356961017"
     variation       5722
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769204792"
     variation       5727
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779457735"
     variation       5731
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1229299286"
     variation       5735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973574478"
     variation       5736
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311575558"
     variation       5739
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748671437"
     variation       5740
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373310579"
     variation       5741
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483424275"
     variation       5744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773585574"
     variation       5745
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749273199"
     variation       5753
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201272664"
     variation       5759
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215713065"
     variation       5761
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778199158"
     variation       5763
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1249483062"
     variation       5764
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1592393907"
     variation       5767
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747563042"
     variation       5771
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893970982"
     variation       5773
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757494792"
     variation       5774..5779
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="atc"
                     /replace="atcatc"
                     /db_xref="dbSNP:1419489454"
     variation       5779
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565392599"
     variation       5780
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396135826"
     variation       5781
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781643198"
     variation       5784
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1229634950"
     variation       5785
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545751147"
     variation       5786
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199955284"
     variation       5790..5794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1203641585"
     variation       5790
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775681531"
     variation       5791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759031271"
     variation       5794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374068486"
     variation       5795
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772123235"
     variation       5797
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254753477"
     variation       5798
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772966997"
     variation       5806
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1042906107"
     variation       5809
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145341685"
     variation       5810
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770595283"
     variation       5813
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776535002"
     variation       5814
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759153407"
     variation       5817
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764934219"
     variation       5820
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1372384478"
     variation       5822
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:560859062"
     variation       5823
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762389768"
     variation       5824
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763662132"
     variation       5827
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357162289"
     variation       5829..5830
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:761248045"
     variation       5831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751970211"
     variation       5834
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1364004763"
     variation       5835
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416902470"
     variation       5836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757804259"
     variation       5837
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750857540"
     variation       5838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014587081"
     variation       5840
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:766629490"
     variation       5842..5852
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tgttgttggcc"
                     /db_xref="dbSNP:755296347"
     variation       5842..5849
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tgttg"
                     /replace="tgttgttg"
                     /db_xref="dbSNP:753935010"
     variation       5844
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201242530"
     variation       5846
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276961485"
     variation       5852
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1444420674"
     variation       5853
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147336554"
     variation       5854..5855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:765583276"
     variation       5855..5856
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aaagaaagaaagatctacaaaggtttctaaacacttacttgaggtt"
                     /db_xref="dbSNP:1565393487"
     variation       5855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367601425"
     variation       5856..5872
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tctctacggatctgata"
                     /db_xref="dbSNP:1565393533"
     variation       5856
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749537807"
     variation       5857
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769340180"
     variation       5859
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779085099"
     variation       5862
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141016456"
     variation       5863
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114501786"
     variation       5864
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759382200"
     variation       5865
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769587453"
     variation       5866
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481459939"
     variation       5867
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1399803331"
     variation       5873
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775056069"
     variation       5874
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762623543"
     variation       5877
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144877654"
     variation       5880
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762196038"
     variation       5881
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749174067"
     variation       5883..5886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tc"
                     /replace="tctc"
                     /db_xref="dbSNP:1169179342"
     variation       5886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768181228"
     variation       5894
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414490769"
     variation       5904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200169711"
     variation       5905
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:565889394"
     variation       5906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364062338"
     variation       5910
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231310621"
     variation       5912
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767055639"
     variation       5917
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895950254"
     variation       5918
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534481630"
     variation       5919
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377123555"
     variation       5920
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145822203"
     variation       5923
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752923046"
     variation       5927
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12765679"
     variation       5930
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220747870"
     variation       5931
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393560870"
     variation       5933..5935
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:777569322"
     variation       5933
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340142931"
     variation       5936
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442203613"
     variation       5937..5939
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:746979348"
     variation       5940
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369648685"
     variation       5941
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751678488"
     variation       5943
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142578469"
     variation       5944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780024892"
     variation       5945
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1273901341"
     variation       5951
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753733864"
     variation       5952
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754737818"
     variation       5955
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1280849029"
     variation       5958
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778606346"
     variation       5964
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422902389"
     variation       5965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184882845"
     variation       5966
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770450758"
     variation       5967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592557165"
     variation       5968
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556529935"
     variation       5972
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444788385"
     variation       5976
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344502759"
     variation       5977
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167402538"
     variation       5978
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369298895"
     variation       5979
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191364618"
     variation       5981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426135207"
     variation       5982
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770573957"
     variation       5983
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350304247"
     variation       5986
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:964403375"
     variation       5990
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394526091"
     variation       5992
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150954247"
     variation       5993
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759990714"
     variation       5997
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140845862"
     variation       5998
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775765147"
     variation       6000
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373555551"
     variation       6001
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182296008"
     variation       6005
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251685959"
     variation       6010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988631023"
     variation       6014
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197580486"
     variation       6016
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1267804748"
     variation       6022
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756957694"
     variation       6034
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303739623"
     variation       6043
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767142432"
     variation       6049
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750095297"
     variation       6057
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447537978"
     variation       6058
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198528351"
     variation       6061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755521071"
     variation       6066
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201603538"
     variation       6071
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1555121169"
     variation       6075
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140413175"
     variation       6076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201214429"
     variation       6082
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362915299"
     variation       6082
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1555121236"
     variation       6083..6099
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccacccccaccaccccc"
                     /replace="ccacccccaccacccccaccaccccc"
                     /db_xref="dbSNP:34095801"
     variation       6083
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1451142111"
     variation       6084
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455549169"
     variation       6085
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1593181463"
     variation       6086..6090
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:1159831976"
     variation       6086
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384973683"
     variation       6087
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424586328"
     variation       6089
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301905535"
     variation       6090
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755517441"
     variation       6091..6094
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="acca"
                     /db_xref="dbSNP:1318215449"
     variation       6091
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779223549"
     variation       6093
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565571513"
     variation       6094
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748566906"
     variation       6095..6100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1565571647"
     variation       6095
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773254764"
     variation       6096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770879290"
     variation       6097
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1241392502"
     variation       6098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776893320"
     variation       6099
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:58106543"
     variation       6100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220348519"
     variation       6101
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765054573"
     variation       6102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1490814775"
     variation       6103
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368856332"
     variation       6105
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1593182285"
     variation       6111
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313463255"
     variation       6112
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1432963606"
     variation       6113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961067010"
     variation       6115
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765841579"
     variation       6118
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138045107"
     variation       6119
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140976774"
     variation       6123
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1382634186"
     variation       6126
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149503672"
     variation       6127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183446641"
     variation       6128
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364012217"
     variation       6133
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758645827"
     variation       6134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778234573"
     variation       6141
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532281287"
     variation       6142
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144751396"
     variation       6150
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177703431"
     variation       6153..6167
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="gatgtggttctgaga"
                     /db_xref="dbSNP:1187559665"
     variation       6153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868704474"
     variation       6156
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565627967"
     variation       6158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776454653"
     variation       6159
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479692439"
     variation       6162
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948411212"
     variation       6166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202010230"
     variation       6168
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745501319"
     variation       6173
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769496601"
     variation       6178
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774860841"
     variation       6180
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175221066"
     variation       6183
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762460420"
     variation       6186
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479278284"
     variation       6189
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268820302"
     variation       6191
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763525770"
     variation       6192
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373068885"
     variation       6196
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762441531"
     variation       6197
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402926596"
     variation       6200
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1284928578"
     variation       6201
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376162843"
     variation       6202..6206
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gg"
                     /replace="ggtgg"
                     /db_xref="dbSNP:1031378520"
     variation       6202
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756389507"
     variation       6206
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329642994"
     variation       6209
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766688126"
     variation       6212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262320291"
     variation       6215
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866000543"
     variation       6221
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148110955"
     variation       6222
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370799288"
     variation       6224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216683665"
     variation       6225
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219899214"
     variation       6226
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1291747880"
     variation       6227
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1361812227"
     variation       6228
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564717762"
     variation       6229
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143883746"
     variation       6235
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780955004"
     variation       6236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437946703"
     variation       6237
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166796802"
     variation       6238..6242
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:773619764"
     variation       6241
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389808854"
     variation       6243
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745730679"
     variation       6247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769483248"
     variation       6248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008585258"
     variation       6250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775150815"
     variation       6253..6254
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:761300973"
     variation       6253
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748916908"
     variation       6254
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773774461"
     variation       6255
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762386374"
     variation       6256..6257
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:771538634"
     variation       6256
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772763191"
     variation       6257
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761051733"
     variation       6260
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766662877"
     variation       6262
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201905665"
     variation       6265
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759721170"
     variation       6267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441037916"
     variation       6277
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296165600"
     variation       6280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375033420"
     variation       6284
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240305957"
     variation       6295
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765341262"
     variation       6296
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176088242"
     variation       6298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313678251"
     variation       6299
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427434133"
     variation       6301
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357969883"
     variation       6302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022571261"
     variation       6306
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291054240"
     variation       6308
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:964270789"
     variation       6309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967106481"
     variation       6310
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752835692"
     variation       6313
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773783823"
     variation       6317..6320
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gtgg"
                     /replace="gtggtgg"
                     /db_xref="dbSNP:777232638"
     variation       6317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029661399"
     variation       6318
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183086070"
     variation       6324
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1241309431"
     variation       6329
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1442703845"
     variation       6333
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165326358"
     variation       6338
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116183037"
     variation       6341
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750376265"
     variation       6342
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755889268"
     variation       6344
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376786391"
     variation       6345
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540765159"
     variation       6348
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560482573"
     variation       6354
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373908144"
     variation       6355
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370168206"
     variation       6356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529296575"
     variation       6366
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771710153"
     variation       6371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:916176525"
     variation       6374
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213227589"
     variation       6378
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275492631"
     variation       6379
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1303099860"
     variation       6382
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773794685"
     variation       6386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761282634"
     variation       6387
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771284294"
     variation       6388
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1462754633"
     variation       6389
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776913120"
     variation       6390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275479836"
     variation       6391
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549215108"
     variation       6399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475016676"
     variation       6400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765447651"
     variation       6402
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1181469493"
     variation       6405
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1425362468"
     variation       6406
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752923829"
     variation       6407
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199696107"
     variation       6410
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1175338836"
     variation       6411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1254138834"
     variation       6414
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7083331"
     variation       6417
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272564235"
     variation       6421
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191111839"
     variation       6423
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756044688"
     variation       6425
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779876538"
     variation       6426
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1334222006"
     variation       6427
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753632492"
     variation       6430
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200529740"
     variation       6433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272291538"
     variation       6434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747813403"
     variation       6435
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771655052"
     variation       6436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1261569123"
     variation       6438
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111994437"
     variation       6439
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747532165"
     variation       6442
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283604528"
     variation       6445
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372635027"
     variation       6448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213489310"
     variation       6455
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777051347"
     variation       6460
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342604887"
     variation       6465
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906864557"
     variation       6469
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746155868"
     variation       6470
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198381623"
     variation       6479
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426827893"
     variation       6483
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1390452206"
     variation       6486
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3750843"
     variation       6490
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172685149"
     variation       6491
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775643365"
     variation       6493
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1383528125"
     variation       6494
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143340046"
     variation       6496
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764129065"
     variation       6497
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114995590"
     variation       6500
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376178888"
     variation       6502
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766292512"
     variation       6503
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760159868"
     variation       6507
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753817518"
     variation       6511
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279050241"
     variation       6514
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754669268"
     variation       6515
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765143512"
     variation       6516
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288126420"
     variation       6517
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752353928"
     variation       6518
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758161048"
     variation       6520
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777412834"
     variation       6521
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746572352"
     variation       6523
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565631962"
     variation       6525
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756797942"
     variation       6526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781496938"
     variation       6528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199969252"
     variation       6538
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468212441"
     variation       6540
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770104155"
     variation       6541
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957496572"
     variation       6544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268321360"
     variation       6545
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1381505226"
     variation       6547
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1424544716"
     variation       6550
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1208559524"
     variation       6551
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029876000"
     variation       6558
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775874142"
     variation       6570
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749489269"
     variation       6571
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139376398"
     variation       6573
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774482969"
     variation       6576
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202246830"
     variation       6577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:79619171"
     variation       6579
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150034118"
     variation       6582
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867989093"
     variation       6586..6591
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1447689928"
     variation       6587
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868039262"
     variation       6591
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866202883"
     variation       6595
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759573053"
     variation       6596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1289335828"
     variation       6600
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358270530"
     variation       6603
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210204744"
     variation       6610
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765090078"
     variation       6611
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435669586"
     variation       6613
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1300809535"
     variation       6620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1593386961"
     variation       6621..6627
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:759725298"
     variation       6622
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1180009063"
     variation       6626
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139868428"
     variation       6627
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183608136"
     variation       6629
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751241062"
     variation       6635
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115286612"
     variation       6637
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780787166"
     variation       6639
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538567560"
     variation       6640
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114199549"
     variation       6648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749720151"
     variation       6649
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1332128588"
     variation       6651
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769011931"
     variation       6655
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915739324"
     variation       6659
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1593387531"
     variation       6663
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196937628"
     variation       6665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:948515169"
     variation       6667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778943409"
     variation       6668
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312917152"
     variation       6670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748421472"
     variation       6671
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1245301953"
     variation       6672
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145907362"
     variation       6675
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1250514618"
     variation       6677
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554116886"
     variation       6684
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202181709"
     variation       6691
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375248756"
     variation       6693
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934338274"
     variation       6695
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463797112"
     variation       6699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773378377"
     variation       6700
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759521622"
     variation       6702
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769922555"
     variation       6703
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775575434"
     variation       6704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424854899"
     variation       6705
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146669395"
     variation       6706
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371630068"
     variation       6707
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467391447"
     variation       6713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171725889"
     variation       6720
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777280236"
     variation       6721
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370832508"
     variation       6726
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115985418"
     variation       6727
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1381295430"
     variation       6733
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750005707"
     variation       6734
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294603489"
     variation       6737
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:914335011"
     variation       6738
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944637263"
     variation       6739
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756607567"
     variation       6743
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369583357"
     variation       6746
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378317701"
     variation       6749
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755283163"
     variation       6753
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114927453"
     variation       6754
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35913854"
     variation       6755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772383562"
     variation       6758
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747020874"
     variation       6764
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371355623"
     variation       6766
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151005188"
     variation       6767
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763017330"
     variation       6770
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768305770"
     variation       6771
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2295873"
     variation       6772
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761359884"
     variation       6774
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359759378"
     variation       6775
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767266341"
     variation       6776
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760120159"
     variation       6777
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765895151"
     variation       6783
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331893143"
     variation       6788
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754298643"
     variation       6789
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298529946"
     variation       6791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755545115"
     variation       6792
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779121471"
     variation       6794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775097315"
     variation       6797
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753160407"
     variation       6799
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312322640"
     variation       6801
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015585332"
     variation       6802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758697172"
     variation       6805
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150139481"
     variation       6806
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138777606"
     variation       6809
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:556551802"
     variation       6810
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2295874"
     variation       6814
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768698106"
     variation       6815
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426135698"
     variation       6817
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368777371"
     variation       6821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747907952"
     variation       6823..6828
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:765296364"
     variation       6823
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771776690"
     variation       6824
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298586776"
     variation       6825
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364667209"
     variation       6827
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434010762"
     variation       6828
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2295875"
     variation       6829
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149346540"
     variation       6830
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1390363878"
     variation       6831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306390301"
     variation       6835
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932746007"
     variation       6836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765839539"
     variation       6837
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:955968932"
     variation       6838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291676037"
     variation       6843
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776164733"
     variation       6846
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224202036"
     variation       6847
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759943943"
     variation       6850
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371850863"
     variation       6851
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753159948"
     variation       6856
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758745427"
     variation       6857
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275295684"
     variation       6860
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441479270"
     variation       6862
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554653985"
     variation       6863
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405097009"
     variation       6865
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1593391165"
     variation       6866
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144863138"
     variation       6867
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781409575"
     variation       6868
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202168550"
     variation       6869
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756151344"
     variation       6871
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040284989"
     variation       6872
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547042157"
     variation       6877
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461134307"
     variation       6879
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778850142"
     variation       6880
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748058471"
     variation       6883
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771859124"
     variation       6884
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773027256"
     variation       6885
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363135915"
     variation       6886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746637680"
     variation       6887
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770625460"
     variation       6890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1169750358"
     variation       6891
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290989544"
     variation       6894
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776111533"
     variation       6895
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759031402"
     variation       6898
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260219289"
     variation       6899
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1458324936"
     variation       6900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375927409"
     variation       6901
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776030064"
     variation       6902
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772054587"
     variation       6907
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567258547"
     variation       6909
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054109938"
     variation       6910
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752028950"
     variation       6912
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:892825068"
     variation       6915
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1004463763"
     variation       6917
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1593392323"
     variation       6918
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168179643"
     variation       6924
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:575786348"
     variation       6925
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35532970"
     variation       6928
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780028150"
     variation       6929
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369011900"
     variation       6931
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148585687"
     variation       6932..6937
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:752879677"
     variation       6932
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114482287"
     variation       6934
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:907333113"
     variation       6936
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745542749"
     variation       6937
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769319405"
     variation       6948
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774912294"
     variation       6950
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763504346"
     variation       6951
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769355165"
     variation       6952
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203132721"
     variation       6953
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775004619"
     variation       6954
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762208855"
     variation       6955
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198068596"
     variation       6957
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1212228565"
     variation       6959
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1003015440"
     variation       6961
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114946191"
     variation       6962
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477398525"
     variation       6963
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2295876"
     variation       6964
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373331825"
     variation       6967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75938210"
     variation       6968
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187285591"
     variation       6970
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956189831"
     variation       6973
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422377862"
     variation       6975
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201583201"
     variation       6977
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758324126"
     variation       6979
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143290941"
     variation       6990
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751522644"
     variation       6994
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11200483"
     variation       6996
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373769936"
     variation       6998
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:745516639"
     variation       7004
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769391107"
     variation       7006
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779612306"
     variation       7009
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748741805"
     variation       7010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211812468"
     variation       7012
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388343217"
     variation       7018
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139126450"
     variation       7020
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774947544"
     variation       7026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1487895676"
     variation       7027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282699180"
     variation       7031
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762439872"
     variation       7032
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543214534"
     variation       7034
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:985529652"
     variation       7038
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264979872"
     variation       7039
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430980605"
     variation       7044
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488422146"
     variation       7046
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921705233"
     variation       7047
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543134454"
     variation       7049
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478746956"
     variation       7061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773494596"
     variation       7068
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777183522"
     variation       7070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944497773"
     variation       7072
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448852295"
     variation       7074
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766573375"
     variation       7090
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361503258"
     variation       7091
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1404718695"
     variation       7098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975894274"
     variation       7101
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200197716"
     variation       7102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200903142"
     variation       7104
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765335838"
     variation       7105
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116727041"
     variation       7106
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948396343"
     variation       7110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237798802"
     variation       7112
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757238700"
     variation       7113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:558512351"
     variation       7115
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370847934"
     variation       7118
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755943697"
     variation       7119
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779516893"
     variation       7121
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198989164"
     variation       7127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374042332"
     variation       7128
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301866447"
     variation       7129
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002609375"
     variation       7136
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868694930"
     variation       7137
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438395704"
     variation       7138
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754496276"
     variation       7143
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778605279"
     variation       7144
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765911016"
     variation       7148
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753269912"
     variation       7153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773617869"
     variation       7155
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747267478"
     variation       7157
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360376530"
     variation       7158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771337694"
     variation       7161
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1593395819"
     variation       7169
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776679676"
     variation       7172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149875675"
     variation       7174
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765282692"
     variation       7179
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954043928"
     variation       7181
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1044360808"
     variation       7186
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775608705"
     variation       7187
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243822780"
     variation       7188
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761734973"
     variation       7194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767291670"
     variation       7197
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750389683"
     variation       7204
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255268589"
     variation       7210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1181478921"
     variation       7213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1019634630"
     variation       7215
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:905990877"
     variation       7218
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755818965"
     variation       7222
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1211698784"
     variation       7227
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1342007948"
     variation       7228
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377341447"
     variation       7230
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763469698"
     variation       7236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423707190"
     variation       7237
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754726978"
     variation       7238
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111795908"
     variation       7240
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778549690"
     variation       7250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473323611"
     variation       7251
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:564839203"
     variation       7254
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1170321699"
     variation       7255
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747723437"
     variation       7259
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757927053"
     variation       7265
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778080991"
     variation       7268
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372505760"
     variation       7269
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377103453"
     variation       7270
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395314344"
     variation       7273
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771171727"
     variation       7275
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1342098788"
     variation       7288
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373771227"
     variation       7291
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199568460"
     variation       7295
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746080998"
     variation       7299
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370327996"
     variation       7300
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315632999"
     variation       7309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770069199"
     variation       7311
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955858634"
     variation       7312
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375899573"
     variation       7313
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183996280"
     variation       7316
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1258869046"
     variation       7318
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443397153"
     variation       7322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768804346"
     variation       7328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421786447"
     variation       7332
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162433155"
     variation       7333
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375253951"
     variation       7335
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763304795"
     variation       7337
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766065502"
     variation       7341
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482751047"
     variation       7343
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914485703"
     variation       7344
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753744351"
     variation       7346
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372356560"
     variation       7353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764912468"
     variation       7356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145140872"
     variation       7361
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337977662"
     variation       7362
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116623673"
     variation       7363
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928356195"
     variation       7367
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311174434"
     variation       7369
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569523562"
     variation       7370
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186794327"
     variation       7371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565642151"
     variation       7372
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346266225"
     variation       7379
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216381943"
     variation       7380
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757845073"
     variation       7381
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312989990"
     variation       7385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1489399224"
     variation       7387
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577051130"
     variation       7393
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194723044"
     variation       7395
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1266933346"
     variation       7397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781537142"
     variation       7401
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036743578"
     variation       7404
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:267602392"
     variation       7407
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746165255"
     variation       7408
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770159087"
     variation       7409
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143162487"
     variation       7414
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763545893"
     variation       7415
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768585905"
     variation       7416
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774537634"
     variation       7418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760516162"
     variation       7419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147830187"
     variation       7422
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384589949"
     variation       7433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868858086"
     variation       7435
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776710818"
     variation       7436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:552066251"
     variation       7439..7451
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aagaagaaga"
                     /replace="aagaagaagaaga"
                     /replace="aagaagaagaagaaga"
                     /db_xref="dbSNP:763225454"
     variation       7440
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239985315"
     variation       7450
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571963100"
     variation       7452
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:907564066"
     variation       7453
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762718237"
     variation       7456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763502836"
     variation       7464
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940269349"
     variation       7465
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1320336169"
     variation       7468
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763735660"
     variation       7472
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220226175"
     variation       7477
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773893094"
     variation       7478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761267022"
     variation       7479
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464691792"
     variation       7480
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757418305"
     variation       7483
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:565690794"
     variation       7484
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750900794"
     variation       7487
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756660624"
     variation       7493..7497
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:1214263040"
     variation       7497
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766713597"
     variation       7500
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754292582"
     variation       7507
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776350847"
     variation       7510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755319544"
     variation       7524
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765550124"
     variation       7525
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577237580"
     variation       7526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192448554"
     variation       7529
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1325364389"
     variation       7532
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200244150"
     variation       7533
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141312062"
     variation       7534
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052019119"
     variation       7536
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243462986"
     variation       7538
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911861882"
     variation       7539
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565655710"
     variation       7545
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779997033"
     variation       7548
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749217706"
     variation       7551
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382353255"
     variation       7552
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430079078"
     variation       7554
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178012692"
     variation       7557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768469173"
     variation       7559
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778624614"
     variation       7563
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1593462190"
     variation       7564
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:879004195"
     variation       7565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767624278"
     variation       7567
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142595789"
     variation       7568
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:971377205"
     variation       7569
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051132992"
     variation       7575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756220208"
     variation       7576
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373229304"
     variation       7577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168974129"
     variation       7580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116132466"
     variation       7585
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1213747876"
     variation       7589
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758150082"
     variation       7590
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438338538"
     variation       7594
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746649237"
     variation       7597
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364796890"
     variation       7603
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472673300"
     variation       7606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908637736"
     variation       7608
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201442031"
     variation       7609
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780903530"
     variation       7618
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139131571"
     variation       7621
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377572872"
     variation       7624
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330722147"
     variation       7642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769368467"
     variation       7648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749854819"
     variation       7650
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538432507"
     variation       7651
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774916657"
     variation       7657
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1243751002"
     variation       7661
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898397711"
     variation       7662
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34944231"
     variation       7663
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767565546"
     variation       7665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256793659"
     variation       7667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150404273"
     variation       7673
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766476440"
     variation       7678
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453396717"
     variation       7679
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251833616"
     variation       7680
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752599030"
     variation       7682
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758378142"
     variation       7687
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420340279"
     variation       7701
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1376263819"
     variation       7704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370266697"
     variation       7705
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35095099"
     variation       7707
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1376331548"
     variation       7710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375024095"
     variation       7711
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745566133"
     variation       7713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755658158"
     variation       7714
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149645012"
     variation       7718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749802502"
     variation       7722
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866276961"
     variation       7725
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395262725"
     variation       7726
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769356942"
     variation       7732
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565662328"
     variation       7735..7741
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cgagacc"
                     /replace="cgagaccgagacc"
                     /db_xref="dbSNP:1371086471"
     variation       7735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774923755"
     variation       7737
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748401716"
     variation       7739
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013086937"
     variation       7741
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1277178257"
     variation       7744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772504256"
     variation       7746
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868356760"
     variation       7749
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773263407"
     variation       7752
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760995785"
     variation       7754
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344881290"
     variation       7761
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199102821"
     variation       7763
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766423134"
     variation       7771
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776748439"
     variation       7774
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193296515"
     variation       7776
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759272845"
     variation       7777
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763964743"
     variation       7779
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751537684"
     variation       7788
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756964036"
     variation       7789
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971347545"
     variation       7792
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988464159"
     variation       7795
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377104806"
     variation       7797
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767389236"
     variation       7798
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377709607"
     variation       7799
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359370122"
     variation       7801
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755891566"
     variation       7802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914245134"
     variation       7803
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201276357"
     variation       7804
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753328740"
     variation       7805
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232820202"
     variation       7811
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:10444046"
     variation       7813
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562449796"
     variation       7814
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368244421"
     variation       7817
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778249068"
     variation       7819
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1486948357"
     variation       7821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747217424"
     variation       7822
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534517363"
     variation       7823
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776853407"
     variation       7825
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759564463"
     variation       7826
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396790368"
     variation       7827
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72840893"
     variation       7831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565663392"
     variation       7832
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769893527"
     variation       7835
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191972822"
     variation       7837
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565114496"
     variation       7838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1289076160"
     variation       7846
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1419170864"
     variation       7847
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389475433"
     variation       7861
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771981610"
     variation       7862
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:956752475"
     variation       7867
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473981288"
     variation       7869
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773293574"
     variation       7874
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565690430"
     variation       7875
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867288575"
     variation       7876
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146144060"
     variation       7878
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373895280"
     variation       7879
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753506322"
     variation       7881
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1356739937"
     variation       7884
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1589724786"
     variation       7888
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750288599"
     variation       7890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759309486"
     variation       7892
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407206360"
     variation       7893
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12268154"
     variation       7896
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467568269"
     variation       7905
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1302564812"
     variation       7908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764639479"
     variation       7909
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752316295"
     variation       7911
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757848963"
     variation       7915
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1589725058"
     variation       7916
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317421107"
     variation       7920
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779179692"
     variation       7922
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552517660"
     variation       7924
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771056377"
     variation       7925
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776714808"
     variation       7927
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138976635"
     variation       7928
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373262025"
     variation       7929
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236227348"
     variation       7931
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303801895"
     variation       7932
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376832058"
     variation       7933
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762563927"
     variation       7935
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369295547"
     variation       7936
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773920791"
     variation       7937
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447130895"
     variation       7942
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212473116"
     variation       7945
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761319926"
     variation       7946
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748599613"
     variation       7951
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1589742133"
     variation       7959
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1268085020"
     variation       7966
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435239520"
     variation       7968
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1194666228"
     variation       7969
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268502166"
     variation       7971
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453432073"
     variation       7973
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1185556095"
     variation       7980
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363639492"
     variation       7981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767958887"
     variation       7984
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142125896"
     variation       7985
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147714181"
     variation       7993
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114701221"
     variation       7994
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534941686"
     variation       7999
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373168589"
     variation       8000
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139196844"
     variation       8003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188626786"
     variation       8004
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:115880388"
     variation       8006
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781226002"
     variation       8008
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334995033"
     variation       8013
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745833341"
     variation       8015
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543630960"
     variation       8016
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350887064"
     variation       8017
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779772714"
     variation       8018
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270664849"
     variation       8019
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61730787"
     variation       8020
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774010181"
     variation       8022
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922043946"
     variation       8023
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436479863"
     variation       8025
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772560651"
     variation       8026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771598263"
     variation       8027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377342486"
     variation       8028
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761132977"
     variation       8035
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1589754619"
     variation       8043
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761236862"
     variation       8047
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771274057"
     variation       8053
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914900340"
     variation       8057
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777206576"
     variation       8058
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1589754763"
     variation       8063
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:969334372"
     variation       8064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564397839"
     variation       8067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288294653"
     variation       8068
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775833159"
     variation       8070..8076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ctgc"
                     /replace="ctgctgc"
                     /db_xref="dbSNP:1230344014"
     variation       8072
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271256611"
     variation       8073
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763325586"
     variation       8075
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764232214"
     variation       8076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111666066"
     variation       8077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751529875"
     variation       8079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233166862"
     variation       8088
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757374526"
     variation       8091
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1259806348"
     variation       8093
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766182197"
     variation       8098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753808693"
     variation       8099
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754732462"
     variation       8100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453598568"
     variation       8111
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778724348"
     variation       8116
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376976062"
     variation       8122
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371140295"
     variation       8126
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777485343"
     variation       8127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746443975"
     variation       8131..8134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gcag"
                     /db_xref="dbSNP:1382193243"
     variation       8131
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770495746"
     variation       8132
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776962329"
     variation       8133
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370858692"
     variation       8135
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200541273"
     variation       8141
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770269399"
     variation       8142
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577886780"
     variation       8146
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359145924"
     variation       8151
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238683112"
     variation       8154
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930801970"
     variation       8156
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004976434"
     variation       8161
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203463385"
     variation       8162
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565704868"
     variation       8165
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763416174"
     variation       8168
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775393485"
     variation       8170..8172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cat"
                     /replace="catcat"
                     /db_xref="dbSNP:1248601100"
     variation       8175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467925153"
     variation       8179
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201932773"
     variation       8180
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1589755909"
     variation       8181
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114249776"
     variation       8182
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267979086"
     variation       8183
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761762767"
     variation       8184
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528927715"
     variation       8186
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753749581"
     variation       8192
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361658773"
     variation       8196
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150511831"
     variation       8197
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944965247"
     variation       8200
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1394419746"
     variation       8208
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292604781"
     variation       8210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765099062"
     variation       8211
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201040344"
     variation       8212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291974723"
     variation       8213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:912402928"
     variation       8214
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762614578"
     variation       8215
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763989975"
     variation       8216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542534555"
     variation       8220
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182505507"
     variation       8223
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256343345"
     variation       8229
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762526471"
     variation       8235
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780998441"
     variation       8239
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61753076"
     variation       8240
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185164847"
     variation       8242..8248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cctc"
                     /replace="cctcctc"
                     /db_xref="dbSNP:1564726084"
     variation       8245
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749844633"
     variation       8246
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356683962"
     variation       8248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1564726248"
     variation       8250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313969799"
     variation       8254
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768884400"
     variation       8255
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1430780689"
     variation       8257
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779388403"
     variation       8261
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748310126"
     variation       8262
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1589768953"
     variation       8266
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569372372"
     variation       8267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773434164"
     variation       8277
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138735982"
     variation       8278
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771028132"
     variation       8279
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1293319065"
     variation       8280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775373741"
     variation       8282
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1002413226"
     variation       8289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:751739873"
     variation       8292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279203734"
     variation       8302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762996567"
     variation       8303
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763792326"
     variation       8305
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751302440"
     variation       8306
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474776848"
     variation       8310
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761527720"
     variation       8313
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392517494"
     variation       8314
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200089235"
     variation       8316
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450511448"
     variation       8320
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147846497"
     variation       8322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393510937"
     variation       8324
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436876678"
     variation       8325
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755658202"
     variation       8328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344731089"
     variation       8329
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428702141"
     variation       8332
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754283055"
     variation       8333
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:539421583"
     variation       8335
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444411645"
     variation       8344
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779289414"
     variation       8346
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302344524"
     variation       8350
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414468282"
     variation       8351..8361
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gagtt"
                     /replace="gagttagagtt"
                     /db_xref="dbSNP:767240818"
     variation       8356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:750417298"
     variation       8357
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336186671"
     variation       8363
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771984054"
     variation       8364
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:865827548"
     variation       8368
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1412881261"
     variation       8372
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567347253"
     variation       8373
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760546620"
     variation       8374
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1388437775"
     variation       8375
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:992998683"
     variation       8376
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765996074"
     variation       8377
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532141781"
     variation       8393
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1334932533"
     variation       8395
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776167726"
     variation       8397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289795919"
     variation       8400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350620257"
     variation       8402
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1232104837"
     variation       8405
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376705581"
     variation       8408
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271866439"
     variation       8410
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1564735508"
     variation       8417
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759045351"
     variation       8418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764692213"
     variation       8421
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375657472"
     variation       8425
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753223988"
     variation       8426
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1436428056"
     variation       8429
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1589779582"
     variation       8430
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1589779626"
     variation       8436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758961340"
     variation       8442
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300712545"
     variation       8443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141377067"
     variation       8448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396085567"
     variation       8451
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484129399"
     variation       8457
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767823235"
     variation       8460
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750641625"
     variation       8461
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145232984"
     variation       8462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2295878"
     variation       8466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867736580"
     variation       8468
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753914817"
     variation       8475
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232416465"
     variation       8478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755134815"
     variation       8479
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1007551291"
     variation       8480
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777816912"
     variation       8482
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746985859"
     variation       8485
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770738881"
     variation       8490
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148958039"
     variation       8491
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745530967"
     variation       8492
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776539571"
     variation       8493
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759597676"
     variation       8495
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775145955"
     variation       8497
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762408075"
     variation       8498
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61753077"
     variation       8499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866260474"
     variation       8503
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762281778"
     variation       8504
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2295879"
     variation       8506
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761809326"
     variation       8511
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176369997"
     variation       8512..8513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:747741502"
     variation       8514
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370782961"
     variation       8519
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766663899"
     variation       8522
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1368553884"
     variation       8527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536628094"
     variation       8537
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866691058"
     variation       8543
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755079853"
     variation       8545
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765459460"
     variation       8546
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75671139"
     variation       8549
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145179415"
     variation       8555
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252684363"
     variation       8558
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139008883"
     variation       8559
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336971324"
     variation       8561
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745600319"
     variation       8569
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268666853"
     variation       8570
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538968585"
     variation       8573
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189176188"
     variation       8576
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449661928"
     variation       8577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779648529"
     variation       8580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448067248"
     variation       8581
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748986288"
     variation       8582
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747566067"
     variation       8589
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771648191"
     variation       8590
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369002161"
     variation       8593
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1564793181"
     variation       8596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:975775977"
     variation       8601
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291433586"
     variation       8609
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377060915"
     variation       8622
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747603637"
     variation       8629
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912316468"
     variation       8638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771411616"
     variation       8640
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372697264"
     variation       8647
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227342028"
     variation       8648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:978317426"
     variation       8659
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564820315"
     variation       8660
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75080758"
     variation       8661
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370762796"
     variation       8662
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746194917"
     variation       8664
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770322124"
     variation       8671
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775552173"
     variation       8674
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142193513"
     variation       8679
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423272950"
     variation       8680
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867489356"
     variation       8689
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768612291"
     variation       8693
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1176806548"
     variation       8696
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774419561"
     variation       8699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761890514"
     variation       8701
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318429487"
     variation       8704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478990548"
     variation       8707
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368788180"
     variation       8708
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762669751"
     variation       8716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414112797"
     variation       8719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:267602393"
     variation       8721
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1470506018"
     variation       8723
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763754108"
     variation       8725
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751297161"
     variation       8728
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406827536"
     variation       8730
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226848799"
     variation       8731
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756806235"
     variation       8733
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1019037833"
     variation       8736
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407465849"
     variation       8737
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309376878"
     variation       8739
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576383974"
     variation       8741
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750960872"
     variation       8751
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756574052"
     variation       8773
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1358939475"
     variation       8774
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780436891"
     variation       8779
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:545114672"
     variation       8791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201589274"
     variation       8792
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146365438"
     variation       8804
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252717696"
     variation       8809
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114739516"
     variation       8810
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772127891"
     variation       8818
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527587471"
     variation       8825
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747065222"
     variation       8826..8831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="atgaga"
                     /db_xref="dbSNP:1589963303"
     variation       8827
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149487619"
     variation       8835
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143941520"
     variation       8836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343531337"
     variation       8842
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762769351"
     variation       8845
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170065040"
     variation       8846
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1589963486"
     variation       8848
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396657872"
     variation       8850
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763843707"
     variation       8854
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774133362"
     variation       8858
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761622230"
     variation       8859
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767282216"
     variation       8860
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749892480"
     variation       8861
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755599004"
     variation       8872
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760029955"
     variation       8881
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765741125"
     variation       8883
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190199335"
     variation       8886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262009486"
     variation       8889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432296611"
     variation       8890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753003533"
     variation       8893
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1564874083"
     variation       8896
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758787417"
     variation       8898
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480448917"
     variation       8900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159111751"
     variation       8904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777932612"
     variation       8906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751771255"
     variation       8907
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372413580"
     variation       8920
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781195910"
     variation       8934
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1385348085"
     variation       8939
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303647079"
     variation       8945
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237279577"
     variation       8949
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745963821"
     variation       8950
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554081729"
     variation       8952
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779013734"
     variation       8953
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376082640"
     variation       8962
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1213968702"
     variation       8963
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772029008"
     variation       8965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406473528"
     variation       8966
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261162550"
     variation       8968
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1488018630"
     variation       8976
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746827175"
     variation       8988
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770435787"
     variation       8989
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309438773"
     variation       8991
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776369229"
     variation       8997
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564879870"
     variation       8998
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1177930005"
     variation       9003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547685475"
     variation       9004
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:567661733"
     variation       9005
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745678131"
     variation       9009
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316975899"
     variation       9010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359848003"
     variation       9020
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227277077"
     variation       9021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763517853"
     variation       9022
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368557628"
     variation       9023
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114931291"
     variation       9026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750694570"
     variation       9027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1482596204"
     variation       9034
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373294737"
     variation       9036
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:56075957"
     variation       9037
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:915433777"
     variation       9040
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:934534722"
     variation       9041
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449221633"
     variation       9042
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186937744"
     variation       9043
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752680886"
     variation       9050
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1410614727"
     variation       9057
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758346924"
     variation       9059
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357493288"
     variation       9060
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1464517939"
     variation       9062
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777783896"
     variation       9063
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383284248"
     variation       9064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780060707"
     variation       9065
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757107024"
     variation       9066
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1363564488"
     variation       9070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780680174"
     variation       9072
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1589974709"
     variation       9077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745570983"
     variation       9078
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769288113"
     variation       9079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201638112"
     variation       9080
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1166152334"
     variation       9086
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376457806"
     variation       9092
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564914901"
     variation       9100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276851285"
     variation       9102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220908859"
     variation       9114
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768248413"
     variation       9127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779260986"
     variation       9128
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311935453"
     variation       9130
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748744464"
     variation       9133
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772316313"
     variation       9140
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773647485"
     variation       9152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360412716"
     variation       9156
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771233836"
     variation       9158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866915985"
     variation       9160
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777028253"
     variation       9161
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902027065"
     variation       9163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1172721621"
     variation       9166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759504397"
     variation       9167
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377142183"
     variation       9170
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1351888215"
     variation       9171
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416840704"
     variation       9173
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1187544287"
     variation       9181
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751439925"
     variation       9182
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:547512577"
     variation       9184
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361936110"
     variation       9188
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223497421"
     variation       9190
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3763763"
     variation       9191
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750169900"
     variation       9196
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755933143"
     variation       9198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234496958"
     variation       9203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374823698"
     variation       9204
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777282532"
     variation       9205
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201048578"
     variation       9206
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753572151"
     variation       9207
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006629992"
     variation       9209
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754430244"
     variation       9211
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778549316"
     variation       9212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369424351"
     variation       9217
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747619110"
     variation       9218
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772575740"
     variation       9224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778450017"
     variation       9231
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1046622000"
     variation       9233
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447930166"
     variation       9235
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282865623"
     variation       9240
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747341499"
     variation       9243
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771462938"
     variation       9246
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759862926"
     variation       9248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769760312"
     variation       9251
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775580610"
     variation       9255
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275047558"
     variation       9258
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181521772"
     variation       9259
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:569504865"
     variation       9262
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750399176"
     variation       9263
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:959269055"
     variation       9264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446174545"
     variation       9271
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416315388"
     variation       9274..9276
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1183854936"
     variation       9274
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1389099504"
     variation       9283..9290
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="taaa"
                     /replace="taaataaa"
                     /db_xref="dbSNP:751463672"
     variation       9284..9292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaat"
                     /replace="aaataaaat"
                     /db_xref="dbSNP:774569712"
     variation       9287
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1169201175"
     variation       9291
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760437099"
     variation       9293
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766216318"
     variation       9296..9298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1458552102"
     variation       9296
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272959843"
     variation       9298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753425741"
     variation       9299
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219898335"
     variation       9308
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748877620"
     variation       9310
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408793518"
     variation       9319..9321
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aga"
                     /db_xref="dbSNP:1453790729"
     variation       9323
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:762007046"
     variation       9324
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363223209"
     variation       9328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1024739984"
     variation       9340
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374062655"
     variation       9356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:966946959"
     variation       9358
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977836267"
     variation       9361
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1270884083"
     variation       9368
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344366660"
     variation       9376
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199822541"
     variation       9391
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778446734"
     variation       9392
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1462490128"
     variation       9395
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1590027493"
     variation       9397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370234122"
     variation       9399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1203996663"
     variation       9404
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247168452"
     variation       9405
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291714220"
     variation       9417
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036258557"
     variation       9422
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1459287529"
     variation       9431
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898819681"
     variation       9445
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1224122716"
     variation       9452
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165778617"
     variation       9454
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778166644"
     variation       9461
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1419286233"
     variation       9467
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1262422910"
     variation       9471
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1180522218"
     variation       9474
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440380617"
     variation       9496
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321148976"
     variation       9502
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189949768"
     variation       9503
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1028662571"
     variation       9506
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305248145"
     variation       9510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1032499439"
     variation       9512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350982712"
     variation       9520
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287705618"
     variation       9522
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:878864233"
     variation       9523
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:15151"
     variation       9528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240327071"
     variation       9531..9533
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:957852098"
     variation       9537
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747511945"
     variation       9538
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388396106"
     variation       9547
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368077329"
     variation       9549
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770390619"
     variation       9553
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185822401"
     variation       9558
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558060686"
     variation       9559
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967563460"
     variation       9566..9570
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tttt"
                     /replace="ttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:910920936"
     variation       9571..9577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:112509232"
     variation       9571
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:191421130"
     variation       9572
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976351124"
     variation       9575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1160673944"
     variation       9579
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1420425324"
     variation       9584
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1590028621"
     variation       9586
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:35785098"
     variation       9588
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977657785"
     variation       9589
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174596543"
     variation       9604..9617
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tctctattgtaaat"
                     /db_xref="dbSNP:1435360193"
     variation       9606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1268515894"
     variation       9607
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193473691"
     variation       9619
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487511484"
     variation       9621
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:929454719"
     variation       9622
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1033234149"
     variation       9636
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047929684"
     variation       9640
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147236944"
ORIGIN      
agtgctgaaaaggagcctctggaagagagggccttctcccgcttctctcctcctcctctccacgctggggggatcctggtcacctctgacaaaattctggggacgctgggaacactgaatcaacatgggcaatgagaacagcacctcggacaaccaggaggactccgtcttgcataacgtcattctgtggcctccaaaccctgagcccacacagaggactttatcagctcagactccaaggtccgcgcagccacccgggaacagtcagaatataaaaaggaagcagcaggacacgcccggaagccctgaccacagagacgcgtccagcattggcagcgttgggcttggaggcttctgcaccgcttctgagagttctgccagcctggatccatgccttgtgtccccagaggtgactgagccaaggaaggacccacagggagccagggggccagaaggttctttgctgcccagcccaccaccgtcccaggagcgagagcacccctcgtcctccatgccctttgccgagtgtcccccggaaggttgcttggcaagtccagcagcggcacctgaagatggtcctcagactcagtctcccaggagggaacctgccccaaatgccccaggagacatcgcggcggcatttcccgctgagagggacagctctactccataccaagagattgctgccgtccccagtgctggaagagagagacagccgaaggaagaaggacagaagtcctccttctccttctccagtggcatcgaccagtcacctggaatgtcgccagtacccctcagagagccaatgaaggcaccgctgtgtggagagggggaccagcctggtggttttgagtcccaagagaaagaggctgcaggtggctttccccctgcagagtccaggcagggggtggcttctgtgcaagtgacccctgaggcccctgctgcagcccagcagggcacagaaagctcagcggtcttggagaagtcccccctaaaacccatggccccgatcccacaagatccagccccaagagcctcagacagagaaagaggccaaggggaggcgccgcctcagtatttaacagatgacttggaattcctcagggcctgccatctccctaggagcaattcaggggctgccccagaagcagaagtgaatgccgcttcccaggagagctgccagcagccagtgggagcatatctgccgcacgcagagctgccctggggcttgccaagtcctgccctggtgccagaggctgggggctctgggaaggaggctctggacaccattgatgttcagggtcacccacagacagggatgcgaggaaccaagcccaatcaagttgtctgtgtggcagcaggcggccagcccgaagggggtttgcctgtgagccctgaaccttccctgctcactccgactgaggaagcacatccagcttcaagcctcgcttcattcccagctgctcagattcctattgctgtagaagaacctggatcatcatccagggaatcagtttccaaggctgggatgccagtttctgcagatgcagccaaagaggtggtggatgcagggttggtgggactggagaggcaggtgtcagatcttggaagcaagggagagcatccagaaggggaccctggagaggttcctgccccatcaccccaggagaggggagagcacttgaacacggagcaaagccatgaggtccaaccaggagtaccaccccctcctcttcccaaggagcaaagccatgaggtccaaccaggagcaccaccccctcctcttcccaaggcaccaagtgaaagtgccagagggccaccggggccaacggatggagccaaggtccatgaagattccacaagcccagccgtggctaaagaaggaagcagatcacctggtgacagccctggaggaaaggaggaagccccagagccacctgatggtggagacccagggaacctgcaaggagaggactctcaggctttcagcagcaagcgtgatccagaagtaggcaaagatgagctttcaaagccaagcagtgatgcagagagcagagaccatcccagctcacactcagcacagccacccagaaaggggggtgctgggcacacggacgggccccactctcagacagcagaggctgatgcatctggcctaccacacaagctgggtgaggaggaccccgtcctgccccctgtgccagatggagctggtgagcccactgttcccgaaggagccatctgggaggggtcaggattgcagcccaaatgtcctgacacccttcagagcagggaaggattgggaagaatggagtctttcctgactttagaatcagagaaatcagattttccaccaactcctgttgcagaggttgcacccaaagcccaggaaggtgagagcacattggaaataaggaagatgggcagctgtgatggggagggcttgctgacgtccccagatcaaccccgcgggccggcgtgtgatgcgtcgagacaggaatttcatgctggggtgccacatcccccccagggggagaacttggcagcagacctggggctcacggcactcatcctggaccaagatcagcagggaatcccatcctgcccaggggaaggctggataagaggagctgcatccgagtggcccctactatcttctgagaagcatctccagccatcccaggcacaaccagagacatccatctttgacgtgctcaaggagcaggcccagccacctgaaaatgggaaagagacttctccaagccatccaggttttaaggaccagggagcagattcttcccaaatccatgtacctgtggaacctcaggaagataacaacttgcccactcatggaggacaggagcaggctttgggatcagaacttcaaagtcagctccccaaaggcaccctgtctgatactccaacttcatctcccactgacatggtttgggagagttctctgacagaagagtcagaattgtcagcaccaacgagacagaagttgcctgcactaggggagaagcggccagagggagcatgcggtgatggtcagtcctcgagggtctcgcctccagcagcagatgtcttaaaagacttttctcttgcagggaacttcagcagaaaggaaacttgctgcactgggcaggggccaaacaagtctcaacaggcattggctgatgccttggaagaaggcagccagcatgaagaagcatgtcaaaggcatccaggagcttctgaagcagctgatggttgttccccactctggggcttgagtaagagggagatggcaagtggaaacacaggggaggccccaccttgtcagcctgactcagtagctctcctggatgcagttccctgcctgccagccctggcgcccgccagccccggagtcacacccacccaggatgccccagagacagaggcatgtgatgaaacccaggaaggcaggcagcaaccagtgccggccccgcagcagaaaatggagtgctgggccacttcggatgcagagtccccaaagcttcttgcaagtttcccatcagctggggagcaaggtggtgaagccggggctgctgagactggtggcagcgctggtgcaggagacccaggaaagcagcaggctccggagaaacctggagaagctactttgagttgtggcctccttcagactgagcactgccttacctccggggaggaagcttctacctctgccctacgtgagtcctgccaagctgagcaccccatggccagctgccaggatgccttgctgccagccagagagctgggtgggattcccaggagcaccatggatttttctacacaccaggctgtcccagacccaaaggagctcctgctgtctgggccaccagaagtggctgctcctgacaccccttacctgcatgtcgacagtgctgcccagagaggagcagaagacagtggagtgaaagctgtttcctctgcagaccccagagctcctggcgaaagcccctgtcctgtaggggagcccccacttgccttggaaaatgctgcctccttgaagctgtttgctggctccctcgcccccctgttgcaaccaggagctgcaggtggggaaatccctgcagtgcaagccagcagtggtagtcccaaagccagaaccactgagggaccagtggactccatgccatgcctggaccggatgccacttctggccaagggcaagcaggcaacaggggaagagaaagcagcaacagctccaggtgcaggtgccaaggccagtggggagggcatggcaggtgatgcagcaggagagacagagggcagcatggagaggatgggagagccttcccaggacccaaagcagggcacatcaggtggtgtggacacaagctctgagcaaatcgccaccctcactggcttcccagacttcagggagcacatcgccaagatcttcgagaagcctgtgctcggagccctggccacacctggagaaaaggcaggagctgggaggagtgcagtgggtaaagacctcaccaggccattgggcccagagaagcttctagatgggcctccaggagtggatgtcacccttctccctgcacctcctgctcgactccaggtggagaagaagcaacagttggctggagaggctgagatttcccatctggctctgcaagatccagcttcagacaagcttctgggtccagcagggctgacctgggagcggaacttgccaggtgccggtgtggggaaggagatggcaggtgtcccacccacactgagggaagacgagaggccagaggggcctggggcagcctggccaggcctggaaggccaggcttactcacagctggagaggagcaggcaggaattagcttcaggtcttccttcaccagcagctactcaggagctccctgtggagagagctgctgccttccaggtggctccccatagccatggagaagaggccgtggcccaagacagaattccttctggaaagcagcaccaggaaacatctgcctgcgacagtccacatggagaagatggtcccggggactttgctcacacaggggttccaggacatgtgccaaggtccacgtgtgccccttctcctcagagggaggttttgactgtgcctgaggccaacagtgagccctggacccttgacacgcttgggggtgaaaggagacccggagtcactgctggcatcttggaaatgcgaaatgccctgggcaaccagagcacccctgcaccaccaactggagaagtggcagacactcccctggagcctggcaaggtggcaggcgctgctggggaagcagagggtgacatcaccctgagcacagctgagacacaggcatgtgcgtccggtgatctgcctgaagcaggtactacgaggacattctccgttgtggcaggtgacttggtgctgccaggaagctgtcaggacccagcctgctctgacaaggctccggggatggagggtacagctgcccttcatggggacagcccagccaggccccagcaggctaaggagcagccagggcctgagcgccccattccagctggggatgggaaggtgtgcgtctcctcacctccagagcctgacgaaactcacgacccgaagctgcaacatttggctccagaagagctccacactgacagagagagccccaggcctggcccatccatgttaccttcggttcctaagaaggatgctccaagagtcatggataaagtcacttcagatgagaccagaggtgcggaaggaacagaaagttcacctgtggcagatgatatcatccagcccgctgcccccgcagacctggaaagcccaaccttagctgcctcttcctaccacggtgatgttgttggccaggtctctacggatctgatagcccagagcatctccccagctgctgcccatgcgggtcttcctccctcggctgcagaacacatagtttcgccatctgccccagctggtgacagagtagaagcttccactccctcctgcccagatccggccaaggacctcagcaggagttccgattctgaagaggcatttgagaccccggagtcaacgacccctgtcaaagctccgccagctccacccccaccaccccccgaagtcatcccagaacccgaggtcagcacacagccacccccggaagaaccaggatgtggttctgagacagtccctgtccctgatggcccacggagcgactcggtggaaggaagtcccttccgtcccccgtcacactccttctctgccgtcttcgatgaagacaagccgatagccagcagtgggacttacaacttggactttgacaacattgagcttgtggatacctttcagaccttggagcctcgtgcctcagacgctaagaatcaggagggcaaagtgaacacacggaggaagtccacggattccgtccccatctctaagtctacactgtcccggtcgctcagcctgcaagccagtgactttgatggtgcttcttcctcaggcaatcccgaggccgtggcccttgccccagatgcatatagcacgggttccagcagtgcttctagtacccttaagcgaactaaaaaaccgaggccgccttccttaaaaaagaaacagaccaccaagaaacccacagagacccccccagtgaaggagacgcaacaggagccagatgaagagagccttgtccccagtggggagaatctagcatctgagacgaaaacggaatctgccaagacggaaggtcctagcccagccttattggaggagacgccccttgagcccgctgtggggcccaaagctgcctgccctctggactcagagagtgcagaaggggttgtccccccggcttctggaggtggcagagtgcagaactcaccccctgtcgggaggaaaacgctgcctcttaccacggccccggaggcaggggaggtaaccccatcggatagcggggggcaagaggactctccagccaaagggctctccgtaaggctggagtttgactattctgaggacaagagtagttgggacaaccagcaggaaaacccccctcctaccaaaaagataggcaaaaagccagttgccaaaatgcccctgaggaggccaaagatgaaaaagacacccgagaaacttgacaacactcctgcctcacctcccagatcccctgctgaacccaatgacatccccattgctaaaggtacttacacctttgatattgacaagtgggatgaccccaattttaaccctttttcttccacctcaaaaatgcaggagtctcccaaactgccccaacaatcatacaactttgacccagacacctgtgatgagtccgttgacccctttaagacatcctctaagacccccagctcaccttctaaatccccagcctcctttgagatcccagccagtgctatggaagccaatggagtggacggggatgggctaaacaagcccgccaagaagaagaagacgcccctaaagacgatggttgaagatgtgatgtctgtgtgttctctgtttgacacatttagggtgaaaaagtcgccaaaacggtctcctctctctgatccaccttcccaggaccccaccccagctgctacaccagaaacaccaccagtgatctctgcggtggtccacgccacagatgaggaaaagctggcggtcaccaaccagaagtggacgtgcatgacagtggacctagaggctgacaaacaggactacccgcagccctcggacctgtccacctttgtaaacgagaccaaattcagttcacccactgagggtaagcaactctgtagccagctggacccccactctgcctcggagaatcctgcccctagggagccaaaggccaggagagaaacttctcagccagagttggattacagaaactcctatgaaattgaatatatggagaaaattggctcctccttacctcaggacgacgatgccccgaagaagcaggccttgtaccttatgtttgacacttctcaggagagccctgtcaagtcatctcccgtccgcatgtcagagtccccgacgccgtgttcagggtcaagttttgaagagactgaagcccttgtgaacactgctgcgaaaaaccagcatcctgtcccacgaggactggcccctaaccaagagtcacacttgcaggtgccagagaaatcctcccagaaggagctggaggccatgggcttgggcaccccttcagaagcgattgaaattacagctcccgagggctcctttgcctctgctgacgccctcctcagcaggctagctcaccccgtctctctctgtggtgcacttgactatctggagcccgacttagcagaaaagaaccccccactattcgctcagaaactccaggaggagttagagtttgccatcatgcggatagaagccctgaagctggccaggcagattgctttggcttcccgcagccaccaggatgccaagagagaggctgctcacccaacagacgtctccatctccaaaacagccttgtactcccgcatcgggaccgctgaggtggagaaacctgcaggccttctgttccagcagcccgacctggactctgccctccagatcgccagagcagagatcataaccaaggagagagaggtctcagaatggaaagataaatatgaagaaagcaggcgggaagtgatggaaatgaggaaaatagtggccgagtatgagaagaccatcgctcagatgatagaggacgaacagagagagaagtcagtctcccaccagacggtgcagcagctggttctggagaaggagcaagccctggccgacctgaactccgtggagaagtctctggccgacctcttcagaagatatgagaagatgaaggaggtcctagaaggcttccgcaagaatgaagaggtgttgaagagatgtgcgcaggagtacctgtcccgggtgaagaaggaggagcagaggtaccaggccctgaaggtgcacgcggaggagaaactggacagggccaatgctgagattgctcaggttcgaggcaaggcccagcaggagcaagccgcccaccaggccagcctgcggaaggagcagctgcgagtggacgccctggaaaggacgctggagcagaagaataaagaaatagaagaactcaccaagatttgtgacgaactgattgccaaaatggggaaaagctaactctgaaccgaatgttttggacttaactgttgcgtgcaatatgaccgtcggcacactgctgttcctccagttccatggacaggttctgttttcactttttcgtatgcactactgtatttcctttctaaataaaattgatttgattgtatgcagtactaaggagactatcagaatttcttgctattggtttgcattttcctagtataattcatagcaagttgacctcagagttcctgtatcagggagattgtctgattctctaataaaagacacattgctgaccttggccttgccctttgtacacaagttcccagggtgagcagcttttggatttaatatgaacatgtacagcgtgcatagggactcttgccttaaggagtgtaaacttgatctgcatttgctgatttgtttttaaaaaaacaagaaatgcatgtttcaaataaaattctctattgtaaataaaattttttctttggatcttggcaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]